LXL04_035060 | RubberDandelionOmics

Gene overview

LXL04_035060

Reference: OH-1004 Chr: Chr08 Coordinates: 13180324-13181882 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1275 bp · LXL04_035060|LXL04_035060|OH1004|cDNA

ATGGCCGGTATGTGTTGTGGTGTTGTTGGTGAAGCGGACACGCCATCGACAGTTGAGCCTAGTGGTGGTCGTCAAGGAAGACGTCGACGGATGGAAATTCATCAGCTTAAATTCCTTGCTGCGGCCGCCTCCGACGAAGTGGCGCCGATGCCGGATAAAGCTAGAAAGCGAAGGAAGGTAGAAAATTTAGAAACGATTGAAAAGAGTGTTACCGGGAAGTCTTTAATTATACCGGCAGCGTGCGAGAAGGTAGTTCAGCC...

CDS

Download CDS FASTA

1275 bp · LXL04_035060|LXL04_035060|OH1004|CDS

ATGGCCGGTATGTGTTGTGGTGTTGTTGGTGAAGCGGACACGCCATCGACAGTTGAGCCTAGTGGTGGTCGTCAAGGAAGACGTCGACGGATGGAAATTCATCAGCTTAAATTCCTTGCTGCGGCCGCCTCCGACGAAGTGGCGCCGATGCCGGATAAAGCTAGAAAGCGAAGGAAGGTAGAAAATTTAGAAACGATTGAAAAGAGTGTTACCGGGAAGTCTTTAATTATACCGGCAGCGTGCGAGAAGGTAGTTCAGCC...

Protein

Download Protein FASTA

424 aa · LXL04_035060|LXL04_035060|OH1004|PROTEIN

MAGMCCGVVGEADTPSTVEPSGGRQGRRRRMEIHQLKFLAAAASDEVAPMPDKARKRRKVENLETIEKSVTGKSLIIPAACEKVVQPCDMMRKEDSRLESSSETEILLNSCKSMSETIVETLQHEEESRFGLTMVCGRRRDMEDAVAVKPLFCGDLHFYGVYDGHGCSHVATKCKDRMHEIVKDEVENRGESPEWKDTLATSFSRMDKEVTEWSEGASISNCRCELQTPQCDAVGSTAVVAVVTPEKIVVSNCGDSRAVL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035060`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035060

Location Chr08:13180324-13181882 (+)

Description Similar to AIP1: Protein phosphatase 2C 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g07430`	Involved in the negative regulation of the K(+) potassium channel AKT1 by its dephosphorylation, antagonistically to CIPK proteins (e.g. CIPK23).	No verified direct reference in this release
`At3g11410`	Major negative regulator of abscisic acid (ABA) responses during seed germination and cold acclimation.	Antisense inhibition of protein phosphatase 2C accelerates cold acclimation in Arabidopsis thaliana.2001 · DOI: 10.1046/j.1365-313x.2001.01048.x Physical and functional interaction of the Arabidopsis K(+) channel AKT2 and phosphatase AtPP2CA.2002 · DOI: 10.1105/tpc.000943 ABA-hypersensitive germination3 encodes a protein phosphatase 2C (AtPP2CA) that strongly regulates abscisic acid signaling during germination among Arabidopsis protein phosphatase 2Cs.2006 · DOI: 10.1104/pp.105.070128 The protein phosphatase AtPP2CA negatively regulates abscisic acid signal transduction in Arabidopsis, and effects of abh1 on AtPP2CA mRNA.2006 · DOI: 10.1104/pp.105.070318 ABA-Hypersensitive Germination1 encodes a protein phosphatase 2C, an essential component of abscisic acid signaling in Arabidopsis seed.2007 · DOI: 10.1111/j.1365-313x.2007.03107.x ABI1 and PP2CA phosphatases are negative regulators of Snf1-related protein kinase1 signaling in Arabidopsis.2013 · DOI: 10.1105/tpc.113.114066
`At2g29380`	Probable protein phosphatase 2C 24.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0846300`	Probable protein phosphatase 2C 9.	No verified direct reference in this release
`Os03g0268600`	Together with ABI5, PYL5 and SAPK2, is part of an abscisic acid (ABA) signaling unit that modulates seed germination and early seedling growth.	A rice orthologue of the ABA receptor, OsPYL/RCAR5, is a positive regulator of the ABA signal transduction pathway in seed germination and early seedling growth.2012 · DOI: 10.1093/jxb/err338

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035060 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009788 negative regulation of abscisic acid-activated signaling pathway Biological Process

GO:0009845 seed germination Biological Process

GO:0009939 positive regulation of gibberellic acid mediated signaling pathway Biological Process

GO:0010030 positive regulation of seed germination Biological Process

GO:0010119 regulation of stomatal movement Biological Process

GO:0010360 negative regulation of anion channel activity Biological Process

GO:0048838 release of seed from dormancy Biological Process

GO:0051607 defense response to virus Biological Process

KEGG gene cross-reference

ath:AT1G07430

ath:AT2G29380

ath:AT3G11410

dosa:Os01g0846300

dosa:Os03g0268600

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.766

Rank 1 · LXL04_035060 · OH-1004

Cytoplasm0.256

Rank 2 · LXL04_035060 · OH-1004

Cell membrane0.079

Rank 3 · LXL04_035060 · OH-1004

Endoplasmic reticulum0.039

Rank 4 · LXL04_035060 · OH-1004

Plastid0.029

Rank 5 · LXL04_035060 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00481.27PP2C130-371 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035060	`PF00481.27`	PP2C	130	371	1.7e-63	215.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LNW3`	Arabidopsis thaliana	Protein phosphatase 2C 3	62.848%	Swiss-Prot	moderate database homology
`P49598`	Arabidopsis thaliana	Protein phosphatase 2C 37	57.796%	Swiss-Prot	strong database homology
`Q9ZW21`	Arabidopsis thaliana	Probable protein phosphatase 2C 24	64.865%	Swiss-Prot	moderate database homology
`Q5N9N2`	Oryza sativa subsp. japonica	Probable protein phosphatase 2C 9	63.125%	Swiss-Prot	moderate database homology
`Q84JI0`	Oryza sativa subsp. japonica	Probable protein phosphatase 2C 30	59.091%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card