LXL04_035017 | RubberDandelionOmics

Gene overview

LXL04_035017

Reference: OH-1004 Chr: Chr08 Coordinates: 11354312-11355520 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

480 bp · LXL04_035017|LXL04_035017|OH1004|cDNA

ATGCTTGAAGGAATTAATACATTAAAGGCGAAAAAATCAACACCTAGCAAGAAAGTTTCAAAATCTTCACGACACTTGGATTTTGTtcacgatgatgatgatgatgcttTAATGAAGGCCATTGCTCTTTCTCCACAAGATTCACCAGGCTTTTTGGATGTAATGACCAAAACTCCCCCTAAAAAGTCAGAGGCAAATGCGTCAGTTGTTGAAAACACTGAAAGTAAGCAGATTGTACATAAAGATGATTCTGGAAACTG...

CDS

Download CDS FASTA

480 bp · LXL04_035017|LXL04_035017|OH1004|CDS

ATGCTTGAAGGAATTAATACATTAAAGGCGAAAAAATCAACACCTAGCAAGAAAGTTTCAAAATCTTCACGACACTTGGATTTTGTTCACGATGATGATGATGATGCTTTAATGAAGGCCATTGCTCTTTCTCCACAAGATTCACCAGGCTTTTTGGATGTAATGACCAAAACTCCCCCTAAAAAGTCAGAGGCAAATGCGTCAGTTGTTGAAAACACTGAAAGTAAGCAGATTGTACATAAAGATGATTCTGGAAACTG...

Protein

Download Protein FASTA

159 aa · LXL04_035017|LXL04_035017|OH1004|PROTEIN

MLEGINTLKAKKSTPSKKVSKSSRHLDFVHDDDDDALMKAIALSPQDSPGFLDVMTKTPPKKSEANASVVENTESKQIVHKDDSGNWKRKTRSGERGISLRDLRRVAASHDFTWTDEEMKHMIDFFDTDADGKLSLEDFTKIVERCNMRQGSENSQLPS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035017`
TK1151 ID	TkA02G385780
OH-1004 ID	LXL04_035017
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	80.600
Protein coverage (%)	TK1151 95.364 / OH-1004 77.358 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_035017`
Location	Chr08:11354312-11355520 (-)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_035017` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0000226 microtubule cytoskeleton organization Biological Process GO:0007099 centriole replication Biological Process GO:0034605 cellular response to heat Biological Process GO:0051301 cell division Biological Process GO:0000922 spindle pole Cellular Component GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005813 centrosome Cellular Component GO:0005814 centriole Cellular Component GO:0005815 microtubule organizing center Cellular Component GO:0005829 cytosol Cellular Component GO:0005929 cilium Cellular Component
KEGG gene cross-reference	mmu:26369 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.460

Rank 1 · LXL04_035017 · OH-1004

Nucleus0.414

Rank 2 · LXL04_035017 · OH-1004

Cell membrane0.148

Rank 3 · LXL04_035017 · OH-1004

Endoplasmic reticulum0.080

Rank 4 · LXL04_035017 · OH-1004

Golgi apparatus0.066

Rank 5 · LXL04_035017 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13499.13EF-hand_798-143 aa

PF13833.13EF-hand_8110-145 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035017	`PF13499.13`	EF-hand_7	98	143	7.4e-06	26.9
LXL04_035017	`PF13833.13`	EF-hand_8	110	145	3.6e-06	27.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card