LXL04_034928 | RubberDandelionOmics

Gene overview

LXL04_034928

Reference: OH-1004 Chr: Chr08 Coordinates: 6955906-6968701 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2589 bp · LXL04_034928|LXL04_034928|OH1004|cDNA

ATGAAACTGTTGCATCAACCACATTCGGGATCAAATCAGGTGCTACTCAGACCACCCATTCATCTGCACCTTCGCCTTCTATTCCCTAATTTGGATGAAAGTGTTCTTAACCCAAAAAGCGGTTTATTTCCCGGACCTGATTCTAAAGCTGCTGATGTTGTTGCTAATCCTGAAGATGAAGAGAAGGAGCTACAACATTGTTCTTTACAAGAAAAACTTGACAATGAGCTCAAAGAACTGGACAAATCTTCAAAACAAGA...

CDS

Download CDS FASTA

2589 bp · LXL04_034928|LXL04_034928|OH1004|CDS

ATGAAACTGTTGCATCAACCACATTCGGGATCAAATCAGGTGCTACTCAGACCACCCATTCATCTGCACCTTCGCCTTCTATTCCCTAATTTGGATGAAAGTGTTCTTAACCCAAAAAGCGGTTTATTTCCCGGACCTGATTCTAAAGCTGCTGATGTTGTTGCTAATCCTGAAGATGAAGAGAAGGAGCTACAACATTGTTCTTTACAAGAAAAACTTGACAATGAGCTCAAAGAACTGGACAAATCTTCAAAACAAGA...

Protein

Download Protein FASTA

862 aa · LXL04_034928|LXL04_034928|OH1004|PROTEIN

MKLLHQPHSGSNQVLLRPPIHLHLRLLFPNLDESVLNPKSGLFPGPDSKAADVVANPEDEEKELQHCSLQEKLDNELKELDKSSKQEQISILSCITQKPKFSIGYPSVSSQQLWKCTGYVPKKFNSQYREFPCVIHSVNQKKDDLKVVKDQNRKKNAKDDSQPHGDEGTGGGGGGGSPQKLTTNNALSYLKLVKDMFHDQREKYKMFLDVMKDFKAQRETGEIGPLAPHADRDLESGEINEDDKTTMKLQKDHKRVSENR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_034928`
TK1151 ID	TkA04G273860
OH-1004 ID	LXL04_034928
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	91.700
Protein coverage (%)	TK1151 98.856 / OH-1004 81.787 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_034928

Location Chr08:6955906-6968701 (-)

Description Similar to BIG: Auxin transport protein BIG

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g02260`	Required for auxin efflux and polar auxin transport (PAT) influencing auxin-mediated developmental responses (e.g. cell elongation, apical dominance, lateral root production, inflorescence architecture, general growth and development).	BIG: a calossin-like protein required for polar auxin transport in Arabidopsis.2001 · DOI: 10.1101/gad.905201 Mutations in the huge Arabidopsis gene BIG affect a range of hormone and light responses.2003 · DOI: 10.1046/j.1365-313x.2003.01779.x The auxin transport inhibitor response 3 (tir3) allele of BIG and auxin transport inhibitors affect the gibberellin status of Arabidopsis.2005 · DOI: 10.1111/j.1365-313x.2004.02287.x CRM1/BIG-mediated auxin action regulates Arabidopsis inflorescence development.2007 · DOI: 10.1093/pcp/pcm094 Arabidopsis mutants define downstream branches in the phototransduction pathway.1994 · DOI: 10.1101/gad.8.3.339 Reduced naphthylphthalamic acid binding in the tir3 mutant of Arabidopsis is associated with a reduction in polar auxin transport and diverse morphological defects.1997 · DOI: 10.1105/tpc.9.5.745
`At1g70060`	Acts as a transcriptional repressor.	No verified direct reference in this release
`At1g24190`	Acts as a transcriptional repressor.	Role of an Arabidopsis AP2/EREBP-type transcriptional repressor in abscisic acid and drought stress responses.2005 · DOI: 10.1105/tpc.105.033043
`At3g01320`	Acts as a transcriptional repressor.	PAH-domain-specific interactions of the Arabidopsis transcription coregulator SIN3-LIKE1 (SNL1) with telomere-binding protein 1 and ALWAYS EARLY2 Myb-DNA binding factors.2010 · DOI: 10.1016/j.jmb.2009.11.065

Rice

Reference gene ID	Possible function	Papers / DOI
`Os09g0247700`	Required for auxin efflux and polar auxin transport (PAT) influencing auxin-mediated developmental responses (e.g. cell elongation, apical dominance, lateral root production, inflorescence architecture, general growth and development) (By similarity).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_034928 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0009620 response to fungus Biological Process

GO:0009640 photomorphogenesis Biological Process

GO:0009733 response to auxin Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0009926 auxin polar transport Biological Process

GO:0010311 lateral root formation Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0048281 inflorescence morphogenesis Biological Process

KEGG gene cross-reference

ath:AT1G24190

ath:AT1G70060

ath:AT3G01320

ath:AT3G02260

dosa:Os09g0247700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.499

Rank 1 · LXL04_034928 · OH-1004

Cytoplasm0.330

Rank 2 · LXL04_034928 · OH-1004

Cell membrane0.142

Rank 3 · LXL04_034928 · OH-1004

Endoplasmic reticulum0.087

Rank 4 · LXL04_034928 · OH-1004

Mitochondrion0.082

Rank 5 · LXL04_034928 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SRU2`	Arabidopsis thaliana	Auxin transport protein BIG	92.105%	Swiss-Prot	weak database homology
`O04539`	Arabidopsis thaliana	Paired amphipathic helix protein Sin3-like 4	73.333%	Swiss-Prot	weak database homology
`O48686`	Arabidopsis thaliana	Paired amphipathic helix protein Sin3-like 3	73.333%	Swiss-Prot	weak database homology
`Q9SRH9`	Arabidopsis thaliana	Paired amphipathic helix protein Sin3-like 1	73.913%	Swiss-Prot	weak database homology
`B9G2A8`	Oryza sativa subsp. japonica	Auxin transport protein BIG	91.892%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card