LXL04_034335 | RubberDandelionOmics

Gene overview

LXL04_034335

Reference: OH-1004 Chr: Chr07 Coordinates: 96818549-96821362 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

945 bp · LXL04_034335|LXL04_034335|OH1004|cDNA

ATGGCCACCATCGTTACCGTTGAAGACGCTTATCCTGGCGTGGACGCTGAACTTCTAAAAAAGGCCTGCCATGGATGGGGAACTGATGAAAAGGCTGTTATATCGATTCTCGCTCATCGAAATGCAACTCAAAGGAAACTGATAAGGGAAGCTTATCAAGATATGTATGGGGAAGATCTTGTCAAGCGACTTGAACATGAGCTATCCGGTGATCTTGAGAGAGCAGTTTACCGATGGAATTTGGATCCTGCGGATCGGGA...

CDS

Download CDS FASTA

945 bp · LXL04_034335|LXL04_034335|OH1004|CDS

ATGGCCACCATCGTTACCGTTGAAGACGCTTATCCTGGCGTGGACGCTGAACTTCTAAAAAAGGCCTGCCATGGATGGGGAACTGATGAAAAGGCTGTTATATCGATTCTCGCTCATCGAAATGCAACTCAAAGGAAACTGATAAGGGAAGCTTATCAAGATATGTATGGGGAAGATCTTGTCAAGCGACTTGAACATGAGCTATCCGGTGATCTTGAGAGAGCAGTTTACCGATGGAATTTGGATCCTGCGGATCGGGA...

Protein

Download Protein FASTA

314 aa · LXL04_034335|LXL04_034335|OH1004|PROTEIN

MATIVTVEDAYPGVDAELLKKACHGWGTDEKAVISILAHRNATQRKLIREAYQDMYGEDLVKRLEHELSGDLERAVYRWNLDPADRDAVLANVALRKEHRDHRVIIELSCTLSPEELFDVKRAYQCRYKRSLEEDIASHTSSDLRKLLVGLVSIHRYQGNEVNLKLANSESNVLRKAIEEKSFDHEEILRIITTRSKPQLKATLNHYKDENGCNMTKHLKDDPANEYTETLRTTIRCMTDPVKYFEKVIRNAIKKSGTNE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_034335`
TK1151 ID	TkA08G010350
OH-1004 ID	LXL04_034335
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_034335

Location Chr07:96818549-96821362 (+)

Description Similar to Annexin-like protein RJ4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g12380`	Annexin D8.	No verified direct reference in this release
`At5g10230`	Annexin D7.	No verified direct reference in this release
`At5g10220`	Annexin D6.	No verified direct reference in this release
`At5g65020`	May mediate regulated, targeted secretion of Golgi-derived vesicles during seedling development.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_034335 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009408 response to heat Biological Process

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009639 response to red or far red light Biological Process

GO:0009651 response to salt stress Biological Process

GO:0015774 polysaccharide transport Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0080022 primary root development Biological Process

GO:0110128 phloem sucrose unloading Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT5G10220

ath:AT5G10230

ath:AT5G12380

ath:AT5G65020

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.449

Rank 1 · LXL04_034335 · OH-1004

Cell membrane0.382

Rank 2 · LXL04_034335 · OH-1004

Nucleus0.235

Rank 3 · LXL04_034335 · OH-1004

Mitochondrion0.057

Rank 4 · LXL04_034335 · OH-1004

Extracellular0.057

Rank 5 · LXL04_034335 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00191.26Annexin15-76 aa

PF00191.26Annexin87-151 aa

PF00191.26Annexin173-231 aa

PF00191.26Annexin244-309 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_034335	`PF00191.26`	Annexin	15	76	2.1e-70	233.4
LXL04_034335	`PF00191.26`	Annexin	87	151	2.1e-70	233.4
LXL04_034335	`PF00191.26`	Annexin	173	231	2.1e-70	233.4
LXL04_034335	`PF00191.26`	Annexin	244	309	2.1e-70	233.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94CK4`	Arabidopsis thaliana	Annexin D8	56.270%	Swiss-Prot	strong database homology
`Q9LX07`	Arabidopsis thaliana	Annexin D7	56.623%	Swiss-Prot	strong database homology
`Q9LX08`	Arabidopsis thaliana	Annexin D6	56.250%	Swiss-Prot	strong database homology
`Q9XEE2`	Arabidopsis thaliana	Annexin D2	54.276%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card