Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1425 bp · LXL04_034249|LXL04_034249|OH1004|cDNA
ATGGACCAACATATACTCTACGACGAAGTTCTAGTAAACGGCGGCAAAACAGCACTGACTTTGTCCGCCGACGGGATACTCCAGTGGCACGATCACGGGAATGTTCTTAAGTGCCTCTCCGTCGAGAGAGAAGTTCTCGGAGTGTCAGTGATTGAACAACAGATCATTATTAGGTCACTGGTTGAGACCGAAAGTGGCGGATTTTGCTTTGGAAGTAGCAGAAGGAATTTGGTGAGGAAGAACTTCGTCTTCGAGGCTTT...
1425 bp · LXL04_034249|LXL04_034249|OH1004|CDS
ATGGACCAACATATACTCTACGACGAAGTTCTAGTAAACGGCGGCAAAACAGCACTGACTTTGTCCGCCGACGGGATACTCCAGTGGCACGATCACGGGAATGTTCTTAAGTGCCTCTCCGTCGAGAGAGAAGTTCTCGGAGTGTCAGTGATTGAACAACAGATCATTATTAGGTCACTGGTTGAGACCGAAAGTGGCGGATTTTGCTTTGGAAGTAGCAGAAGGAATTTGGTGAGGAAGAACTTCGTCTTCGAGGCTTT...
Protein
Download Protein FASTA474 aa · LXL04_034249|LXL04_034249|OH1004|PROTEIN
MDQHILYDEVLVNGGKTALTLSADGILQWHDHGNVLKCLSVEREVLGVSVIEQQIIIRSLVETESGGFCFGSSRRNLVRKNFVFEALSQDSLRNLCEKIQGYVDTLGRPKKLFIFVNPFGGRKSASKVFTDDVKPILEDANIEYTLQETKYQLHAKEVAHTLDLTKYDGIICVSGDGILVEVVNGLLEREDWQVAMKMAIGVIPAGTGNGMIKSLLDSVGQPCTAAYAMLTAIRGHKRCLDVATIWQKETKFFSVLMLAW...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_034249 |
|---|---|
| TK1151 ID | TkA08G409980 |
| OH-1004 ID | LXL04_034249 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 99.100 |
| Protein coverage (%) | TK1151 97.699 / OH-1004 98.312Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_034249 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr07:93211234-93215245 (+) | |||||||||
| Description | Similar to SPHK2: Sphingosine kinase 2 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0001934 positive regulation of protein phosphorylation Biological Process GO:0006473 protein acetylation Biological Process GO:0006665 sphingolipid metabolic process Biological Process GO:0006670 sphingosine metabolic process Biological Process GO:0008284 positive regulation of cell population proliferation Biological Process GO:0009267 cellular response to starvation Biological Process GO:0009737 response to abscisic acid Biological Process GO:0009845 seed germination Biological Process GO:0010803 regulation of tumor necrosis factor-mediated signaling pathway Biological Process GO:0014075 response to amine Biological Process GO:0016310 phosphorylation Biological Process GO:0019722 calcium-mediated signaling Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT4G21534 ath:AT4G21540 hsa:8877 mmu:20698 rno:170897 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00781.30DAGK_cat111-244 aaPF19280.5CERK_C269-471 aaPF19279.5YegS_C363-442 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_034249 | PF00781.30 | DAGK_cat | 111 | 244 | 2.1e-28 | 99.1 |
| LXL04_034249 | PF19280.5 | CERK_C | 269 | 471 | 3.3e-07 | 30.7 |
| LXL04_034249 | PF19279.5 | YegS_C | 363 | 442 | 3.9e-12 | 46.9 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.