LXL04_034229 | RubberDandelionOmics

Gene overview

LXL04_034229

Reference: OH-1004 Chr: Chr07 Coordinates: 92338793-92340504 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

681 bp · LXL04_034229|LXL04_034229|OH1004|cDNA

ATGGCGAATTACCATGGGGATTTCAACCAGAAGATTGATTACGTGTTTAAGATCGTACTGATTGGGGACTCGGCGGTGGGGAAATCTCAGTTGTTGGCTCGGTTTTCTAGGAATGAGTTCAGTTTAGATTCAAAGGCGACGATTGGTGTTGAGTTCCAGACGAAGACTATGGTTATCGATCACAAGAACATCAAGGCTCAAATTTGGGACACTGCTGGTCAAGAAAGATACAGAGCCGTAACTAGCGCGTACTACAGAGG...

CDS

Download CDS FASTA

681 bp · LXL04_034229|LXL04_034229|OH1004|CDS

ATGGCGAATTACCATGGGGATTTCAACCAGAAGATTGATTACGTGTTTAAGATCGTACTGATTGGGGACTCGGCGGTGGGGAAATCTCAGTTGTTGGCTCGGTTTTCTAGGAATGAGTTCAGTTTAGATTCAAAGGCGACGATTGGTGTTGAGTTCCAGACGAAGACTATGGTTATCGATCACAAGAACATCAAGGCTCAAATTTGGGACACTGCTGGTCAAGAAAGATACAGAGCCGTAACTAGCGCGTACTACAGAGG...

Protein

Download Protein FASTA

226 aa · LXL04_034229|LXL04_034229|OH1004|PROTEIN

MANYHGDFNQKIDYVFKIVLIGDSAVGKSQLLARFSRNEFSLDSKATIGVEFQTKTMVIDHKNIKAQIWDTAGQERYRAVTSAYYRGAVGAMLVYDITKRQSFDDIARWLEELRGHSDNTNIIIMLIGNKSDLDSQRDVTTEDAKEFAEREGLYFMETSALEATNVEPAFLTILTQIYQTVSKKSLVANEEADGTSALLKGTNILLPPPQQQQIYGESKFGCCTSS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_034229`
TK1151 ID	TkA08G384930
OH-1004 ID	LXL04_034229
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	89.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_034229

Location Chr07:92338793-92340504 (+)

Description Similar to RABA4D: Ras-related protein RABA4d

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g12160`	Intracellular vesicle trafficking and protein transport.	The Rab GTPase RabA4d regulates pollen tube tip growth in Arabidopsis thaliana.2009 · DOI: 10.1105/tpc.108.060277
`At5g47960`	Intracellular vesicle trafficking and protein transport.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os09g0281700`	May play an important role in plant growth and development.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_034229 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009860 pollen tube growth Biological Process

GO:0015031 protein transport Biological Process

GO:0048868 pollen tube development Biological Process

GO:0080092 regulation of pollen tube growth Biological Process

GO:0005768 endosome Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009536 plastid Cellular Component

GO:0030659 cytoplasmic vesicle membrane Cellular Component

GO:0045177 apical part of cell Cellular Component

GO:0070382 exocytic vesicle Cellular Component

KEGG gene cross-reference

ath:AT3G12160

ath:AT5G47960

nta:107766135

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.461

Rank 1 · LXL04_034229 · OH-1004

Golgi apparatus0.336

Rank 2 · LXL04_034229 · OH-1004

Cell membrane0.256

Rank 3 · LXL04_034229 · OH-1004

Lysosome / Vacuole0.194

Rank 4 · LXL04_034229 · OH-1004

Endoplasmic reticulum0.122

Rank 5 · LXL04_034229 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00025.28Arf15-139 aa

PF00071.29Ras17-178 aa

PF08477.20Roc17-132 aa

PF01926.30MMR_HSR117-124 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_034229	`PF00025.28`	Arf	15	139	1.2e-15	58.1
LXL04_034229	`PF00071.29`	Ras	17	178	5.1e-63	212.2
LXL04_034229	`PF08477.20`	Roc	17	132	3.4e-34	118.4
LXL04_034229	`PF01926.30`	MMR_HSR1	17	124	3.1e-06	28.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LH50`	Arabidopsis thaliana	Ras-related protein RABA4d	74.890%	Swiss-Prot	strong database homology
`Q9FE79`	Arabidopsis thaliana	Ras-related protein RABA4c	72.926%	Swiss-Prot	strong database homology
`P25766`	Oryza sativa subsp. japonica	Ras-related protein RGP1	74.888%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card