LXL04_034075 | RubberDandelionOmics

Gene overview

LXL04_034075

Reference: OH-1004 Chr: Chr07 Coordinates: 79922275-79934779 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1464 bp · LXL04_034075|LXL04_034075|OH1004|cDNA

ATGAAATCTTCAAATCGCTGTTCAGTTATCATCGTCGGAGCCGGAATTTCAGGCATATCGGCAGCGAAGGTATTGGCCCAGAATGGTGTGGAGGACATTTTGATACTTGAGGCGTCGGATAGTGTCGGTGGAAGAATAAAAAAGCACAATTTCGGAAACATATCCGTGGAGCTCGGTGCCGGTTGGATCGCCGGTGTTGGTGGAAAAGAACCTAATCCTGTTTGGGAGTTAGCTGCTCAATCCGGTCTTCGTACATGCTT...

CDS

Download CDS FASTA

1464 bp · LXL04_034075|LXL04_034075|OH1004|CDS

ATGAAATCTTCAAATCGCTGTTCAGTTATCATCGTCGGAGCCGGAATTTCAGGCATATCGGCAGCGAAGGTATTGGCCCAGAATGGTGTGGAGGACATTTTGATACTTGAGGCGTCGGATAGTGTCGGTGGAAGAATAAAAAAGCACAATTTCGGAAACATATCCGTGGAGCTCGGTGCCGGTTGGATCGCCGGTGTTGGTGGAAAAGAACCTAATCCTGTTTGGGAGTTAGCTGCTCAATCCGGTCTTCGTACATGCTT...

Protein

Download Protein FASTA

487 aa · LXL04_034075|LXL04_034075|OH1004|PROTEIN

MKSSNRCSVIIVGAGISGISAAKVLAQNGVEDILILEASDSVGGRIKKHNFGNISVELGAGWIAGVGGKEPNPVWELAAQSGLRTCFSDYSNARYNIYDRSGEIFPSGVAGDTYKKAVESAIEKLRTDQDSLLAADVSDVPKLSTIPKTPIELAIDFILHDFEMAEVEPISTYVDFGEREFLVADERGYEYLLYKMAEEFLFTSDGKILDNRLKLNTVVRELQHSRDGVTVRTEDGCVYEANYVILSVSIGVLQSPLISF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_034075`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_034075

Location Chr07:79922275-79934779 (+)

Description Similar to PAO1: Polyamine oxidase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g13700`	Flavoenzyme involved in polyamine back-conversion.	Heterologous expression and biochemical characterization of a polyamine oxidase from Arabidopsis involved in polyamine back conversion.2006 · DOI: 10.1104/pp.106.080911 Characterization of five polyamine oxidase isoforms in Arabidopsis thaliana.2010 · DOI: 10.1007/s00299-010-0881-1 Functional diversity inside the Arabidopsis polyamine oxidase gene family.2011 · DOI: 10.1093/jxb/erq341 Reducing Cytoplasmic Polyamine Oxidase Activity in Arabidopsis Increases Salt and Drought Tolerance by Reducing Reactive Oxygen Species Production and Increasing Defense Gene Expression.2016 · DOI: 10.3389/fpls.2016.00214

Rice

Reference gene ID	Possible function	Papers / DOI
`Os09g0368200`	Flavoenzyme involved in polyamine back-conversion (By similarity).	No verified direct reference in this release
`Os09g0368500`	Flavoenzyme involved in polyamine back-conversion.	Polyamine oxidase 7 is a terminal catabolism-type enzyme in Oryza sativa and is specifically expressed in anthers.2014 · DOI: 10.1093/pcp/pcu047

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_034075 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006598 polyamine catabolic process Biological Process

GO:0046203 spermidine catabolic process Biological Process

GO:0046208 spermine catabolic process Biological Process

GO:1903602 thermospermine catabolic process Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0048046 apoplast Cellular Component

GO:0046592 polyamine oxidase activity Molecular Function

GO:0050660 flavin adenine dinucleotide binding Molecular Function

GO:0052897 N8-acetylspermidine:oxygen oxidoreductase (propane-1,3-diamine-forming) activity Molecular Function

GO:0052900 spermine oxidase (propane-1,3-diamine-forming) activity Molecular Function

GO:0052901 spermine oxidase activity Molecular Function

KEGG gene cross-reference

ath:AT5G13700

dosa:Os09g0368200

dosa:Os09g0368500

zma:541983

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.386

Rank 1 · LXL04_034075 · OH-1004

Peroxisome0.173

Rank 2 · LXL04_034075 · OH-1004

Extracellular0.156

Rank 3 · LXL04_034075 · OH-1004

Nucleus0.119

Rank 4 · LXL04_034075 · OH-1004

Mitochondrion0.082

Rank 5 · LXL04_034075 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01494.26FAD_binding_37-36 aa

PF01266.31DAO9-106 aa

PF13450.13NAD_binding_811-77 aa

PF01593.31Amino_oxidase16-432 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_034075	`PF01494.26`	FAD_binding_3	7	36	4.2e-06	27.0
LXL04_034075	`PF01266.31`	DAO	9	106	6.7e-09	36.5
LXL04_034075	`PF13450.13`	NAD_binding_8	11	77	3.5e-12	47.1
LXL04_034075	`PF01593.31`	Amino_oxidase	16	432	2.7e-67	228.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FNA2`	Arabidopsis thaliana	Polyamine oxidase 1	76.794%	Swiss-Prot	strong database homology
`A0A0P0XM10`	Oryza sativa subsp. japonica	Polyamine oxidase 6	46.696%	Swiss-Prot	moderate database homology
`Q0J290`	Oryza sativa subsp. japonica	Polyamine oxidase 7	45.561%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card