LXL04_034066 | RubberDandelionOmics

Gene overview

LXL04_034066

Reference: OH-1004 Chr: Chr07 Coordinates: 79302107-79306782 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1254 bp · LXL04_034066|LXL04_034066|OH1004|cDNA

ATGCTTCCTACTTCGGATTCCATCTCGGCTTCGGAAACTCCATCCAGCATCGGAGACTTGGCGCTTCGGACTCCTCTACCGCTTCGGAATCCCGTTTCGGCCTCGGAAACCATCTTCCGGAGTCACCCTCTTCCGCAACCCATCCAACTGTCGCAGCAATTTCATAGCTCCGAAGTAACCCTTTTCACGATCATCATCGTTAATTTCAACCTACCAATGAAAGGCGGATTTTCTGTCTCAGACGGGAGCTCCAGACCTTC...

CDS

Download CDS FASTA

1254 bp · LXL04_034066|LXL04_034066|OH1004|CDS

ATGCTTCCTACTTCGGATTCCATCTCGGCTTCGGAAACTCCATCCAGCATCGGAGACTTGGCGCTTCGGACTCCTCTACCGCTTCGGAATCCCGTTTCGGCCTCGGAAACCATCTTCCGGAGTCACCCTCTTCCGCAACCCATCCAACTGTCGCAGCAATTTCATAGCTCCGAAGTAACCCTTTTCACGATCATCATCGTTAATTTCAACCTACCAATGAAAGGCGGATTTTCTGTCTCAGACGGGAGCTCCAGACCTTC...

Protein

Download Protein FASTA

417 aa · LXL04_034066|LXL04_034066|OH1004|PROTEIN

MLPTSDSISASETPSSIGDLALRTPLPLRNPVSASETIFRSHPLPQPIQLSQQFHSSEVTLFTIIIVNFNLPMKGGFSVSDGSSRPSVDASSDCSAPEVDRITIATTTGVTESSQLYADRLHLILRYISAEKLLINGRLFLIETLFIENEVEALYELFEKLSSSLHVDGLIGKDEFLLPLFRDHGQRKLFADRIFDLFDVNRSGHIDFTEFVRSLGVFHPKAPQAEKILFILSPAIKQRSMDGGQKGLTPSQICVILRDS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_034066`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_034066

Location Chr07:79302107-79306782 (-)

Description Similar to CBL4: Calcineurin B-like protein 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g24270`	May act as a calcium sensor regulating intracellular Na⁺/K⁺ homeostasis and salt tolerance.	The Arabidopsis SOS2 protein kinase physically interacts with and is activated by the calcium-binding protein SOS3.2000 · DOI: 10.1073/pnas.97.7.3735 SOS3 function in plant salt tolerance requires N-myristoylation and calcium binding.2000 · DOI: 10.1105/tpc.12.9.1667 Regulation of SOS1, a plasma membrane Na+/H+ exchanger in Arabidopsis thaliana, by SOS2 and SOS3.2002 · DOI: 10.1073/pnas.122224699 Calcium-dependent modulation and plasma membrane targeting of the AKT2 potassium channel by the CBL4/CIPK6 calcium sensor/protein kinase complex.2011 · DOI: 10.1038/cr.2011.50 Arabidopsis SOS3 plays an important role in salt tolerance by mediating calcium-dependent microfilament reorganization.2013 · DOI: 10.1007/s00299-012-1348-3
`At5g47100`	Acts as a calcium sensor involved in abscisic acid (ABA) signaling and stress-induced ABA biosynthesis pathways.	The calcium sensor calcineurin B-like 9 modulates abscisic acid sensitivity and biosynthesis in Arabidopsis.2004 · DOI: 10.1105/tpc.021311 A protein kinase, interacting with two calcineurin B-like proteins, regulates K+ transporter AKT1 in Arabidopsis.2006 · DOI: 10.1016/j.cell.2006.06.011 Two calcineurin B-like calcium sensors, interacting with protein kinase CIPK23, regulate leaf transpiration and root potassium uptake in Arabidopsis.2007 · DOI: 10.1111/j.1365-313x.2007.03236.x The Calcineurin B-like calcium sensors CBL1 and CBL9 together with their interacting protein kinase CIPK26 regulate the Arabidopsis NADPH oxidase RBOHF.2013 · DOI: 10.1093/mp/sst009

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0291000`	Acts as a calcium sensor.	No verified direct reference in this release
`Os05g0534400`	Acts as a calcium sensor involved in the regulatory pathway for the control of intracellular Na(+) and K(+) homeostasis and salt tolerance.	Conservation of the salt overly sensitive pathway in rice.2007 · DOI: 10.1104/pp.106.092635
`Os02g0291400`	Acts as a calcium sensor.	Expression analysis of the calcineurin B-like gene family in rice (Oryza sativa L.) under environmental stresses.2008 · DOI: 10.1016/j.gene.2008.02.011

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_034066 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005513 detection of calcium ion Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0019722 calcium-mediated signaling Biological Process

GO:0030007 intracellular potassium ion homeostasis Biological Process

GO:0042539 hypotonic salinity response Biological Process

GO:0071472 cellular response to salt stress Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0005955 calcineurin complex Cellular Component

KEGG gene cross-reference

ath:AT5G24270

ath:AT5G47100

dosa:Os02g0291000

dosa:Os05g0534400

osa:107276173

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.459

Rank 1 · LXL04_034066 · OH-1004

Nucleus0.404

Rank 2 · LXL04_034066 · OH-1004

Mitochondrion0.125

Rank 3 · LXL04_034066 · OH-1004

Cell membrane0.091

Rank 4 · LXL04_034066 · OH-1004

Endoplasmic reticulum0.069

Rank 5 · LXL04_034066 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00036.39EF-hand_1192-213 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_034066	`PF00036.39`	EF-hand_1	192	213	1.9e-06	27.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O81223`	Arabidopsis thaliana	Calcineurin B-like protein 4	67.816%	Swiss-Prot	weak database homology
`Q9LTB8`	Arabidopsis thaliana	Calcineurin B-like protein 9	61.364%	Swiss-Prot	weak database homology
`Q3HRP0`	Oryza sativa subsp. japonica	Calcineurin B-like protein 7	64.773%	Swiss-Prot	weak database homology
`Q75KU4`	Oryza sativa subsp. japonica	Calcineurin B-like protein 4	61.364%	Swiss-Prot	weak database homology
`Q3HRN9`	Oryza sativa subsp. japonica	Calcineurin B-like protein 8	60.227%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card