LXL04_033936 | RubberDandelionOmics

Gene overview

LXL04_033936

Reference: OH-1004 Chr: Chr07 Coordinates: 67045081-67046786 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1230 bp · LXL04_033936|LXL04_033936|OH1004|cDNA

ATGAAAAATACACTTTTCTTTGTATTTCCTACAATTTCTGACATATGTTGTTTACTTACATACTATGTGCAGTTCTATCATTCAAAGAAGAAACATAAGTTTGTATCACCCATTTTAAAATCTGGAACAATCGAACAAAATGCAAATTCTTCACTTGAAGGGTCATCTTATAAGCAAGATCAAGTAAGAAGAAATCTAATATCAGAGATAGAATCATCTTCAAGATataaagacatggaaactatATCTACTATCCAGGG...

CDS

Download CDS FASTA

1230 bp · LXL04_033936|LXL04_033936|OH1004|CDS

ATGAAAAATACACTTTTCTTTGTATTTCCTACAATTTCTGACATATGTTGTTTACTTACATACTATGTGCAGTTCTATCATTCAAAGAAGAAACATAAGTTTGTATCACCCATTTTAAAATCTGGAACAATCGAACAAAATGCAAATTCTTCACTTGAAGGGTCATCTTATAAGCAAGATCAAGTAAGAAGAAATCTAATATCAGAGATAGAATCATCTTCAAGATATAAAGACATGGAAACTATATCTACTATCCAGGG...

Protein

Download Protein FASTA

409 aa · LXL04_033936|LXL04_033936|OH1004|PROTEIN

MKNTLFFVFPTISDICCLLTYYVQFYHSKKKHKFVSPILKSGTIEQNANSSLEGSSYKQDQVRRNLISEIESSSRYKDMETISTIQGHQRENMKHIIGGLSNKRKGNDSPSVSDLEDKSNKKMHLSSIKETNVGNELSLRKCIRTSMEAVDVTSCNTPRRQIVKLATEESPQSMQGSSIVSPGDAFWKEALQVFDEMSNHNKHLYEHVEEPKGSGQFEINHIDDVSNQSNDNRSCNTPSVDIKSCDVDILKSVESISSSC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_033936`
TK1151 ID	TkA01G254990
OH-1004 ID	LXL04_033936
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	98.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_033936

Location Chr07:67045081-67046786 (-)

Description Similar to TEB: Helicase and polymerase-containing protein TEBICHI

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g32700`	Required for regulated cell division and differentiation in meristems and embryos, thus modulating adaxial-abaxial polarity.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033936 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0000731 DNA synthesis involved in DNA repair Biological Process

GO:0006261 DNA-templated DNA replication Biological Process

GO:0006281 DNA repair Biological Process

GO:0006284 base-excision repair Biological Process

GO:0006302 double-strand break repair Biological Process

GO:0006974 DNA damage response Biological Process

GO:0009640 photomorphogenesis Biological Process

GO:0009933 meristem structural organization Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0010792 DNA double-strand break processing involved in repair via single-strand annealing Biological Process

GO:0031297 replication fork processing Biological Process

KEGG gene cross-reference

ath:AT4G32700

dme:Dmel_CG6019

hsa:10721

hsa:113510

mmu:77782

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.914

Rank 1 · LXL04_033936 · OH-1004

Cytoplasm0.174

Rank 2 · LXL04_033936 · OH-1004

Cell membrane0.030

Rank 3 · LXL04_033936 · OH-1004

Mitochondrion0.022

Rank 4 · LXL04_033936 · OH-1004

Endoplasmic reticulum0.017

Rank 5 · LXL04_033936 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00270.36DEAD302-385 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_033936	`PF00270.36`	DEAD	302	385	1.1e-06	29.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q588V7`	Arabidopsis thaliana	Helicase and polymerase-containing protein TEBICHI	70.248%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card