Gene Card
Gene overview
cDNA / CDS / Protein Sequences
432 bp · LXL04_033852|LXL04_033852|OH1004|cDNA
ATGGCAACCATAACTCCTCCGCTCTTCCTCGCCCTTGTCTTCTCCATCATCGTCTTAGGGATCGTATTAGGACCTACAAATGGACAAGCACCTGGACAGCCAACTTGGTGTGTGGCAAAGCCATCGGCTTCTGATATAGAACTGTATAATAACATGCATTATTCTTGCGATTATGTGAACTGCGATGTGATAAATCCACAAGGTGCTTGTTACTATCCTCGAATTCTTATCAACCAAGCTTCAGTTGTCATGAATGCGTA...
432 bp · LXL04_033852|LXL04_033852|OH1004|CDS
ATGGCAACCATAACTCCTCCGCTCTTCCTCGCCCTTGTCTTCTCCATCATCGTCTTAGGGATCGTATTAGGACCTACAAATGGACAAGCACCTGGACAGCCAACTTGGTGTGTGGCAAAGCCATCGGCTTCTGATATAGAACTGTATAATAACATGCATTATTCTTGCGATTATGTGAACTGCGATGTGATAAATCCACAAGGTGCTTGTTACTATCCTCGAATTCTTATCAACCAAGCTTCAGTTGTCATGAATGCGTA...
Protein
Download Protein FASTA143 aa · LXL04_033852|LXL04_033852|OH1004|PROTEIN
MATITPPLFLALVFSIIVLGIVLGPTNGQAPGQPTWCVAKPSASDIELYNNMHYSCDYVNCDVINPQGACYYPRILINQASVVMNAYYQKQGRNYWNCDFNKSGLITIVDPSKPNNKSSTPFDEIMINGICCFAGYGNCRFDS
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_033852 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_033852 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr07:60973540-60974208 (+) | |||||||||
| Description | Similar to OLE9: Glucan endo-1,3-beta-D-glucosidase | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0005975 carbohydrate metabolic process Biological Process GO:0006076 (1->3)-beta-D-glucan catabolic process Biological Process GO:0006952 defense response Biological Process GO:0071555 cell wall organization Biological Process GO:0005576 extracellular region Cellular Component GO:0005886 plasma membrane Cellular Component GO:0009506 plasmodesma Cellular Component GO:0016020 membrane Cellular Component GO:0031410 cytoplasmic vesicle Cellular Component GO:0098552 side of membrane Cellular Component GO:0001872 (1->3)-beta-D-glucan binding Molecular Function GO:0030247 polysaccharide binding Molecular Function | |||||||||
| KEGG gene cross-reference | ath:AT1G18650 ath:AT4G34480 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF07983.19X835-104 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_033852 | PF07983.19 | X8 | 35 | 104 | 9.7e-18 | 65.3 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.