LXL04_033809 | RubberDandelionOmics

Gene overview

LXL04_033809

Reference: OH-1004 Chr: Chr07 Coordinates: 58921519-58926948 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3600 bp · LXL04_033809|LXL04_033809|OH1004|cDNA

ATGGTTGTTCTCTCCAAACTCCTCTTAGAAGAATCTTCATCTACTTCATCAACTCATGTTCATAGTTCATCAACTCACGGTCATAGTTCATTAACTAATATGCCTAGCTACGATGTATACTTAAGTTTTAGGGATCTTGACACTCGTCATAGTTTCATATATGACCTTTATGAGGCCCTTATTGATGCCAATATCACTACTTTTTTGGACGATGAAGAGATTGAAACCGAGGAAGATCTGAAACCGGAATTGGAGAGTGC...

CDS

Download CDS FASTA

3600 bp · LXL04_033809|LXL04_033809|OH1004|CDS

ATGGTTGTTCTCTCCAAACTCCTCTTAGAAGAATCTTCATCTACTTCATCAACTCATGTTCATAGTTCATCAACTCACGGTCATAGTTCATTAACTAATATGCCTAGCTACGATGTATACTTAAGTTTTAGGGATCTTGACACTCGTCATAGTTTCATATATGACCTTTATGAGGCCCTTATTGATGCCAATATCACTACTTTTTTGGACGATGAAGAGATTGAAACCGAGGAAGATCTGAAACCGGAATTGGAGAGTGC...

Protein

Download Protein FASTA

1199 aa · LXL04_033809|LXL04_033809|OH1004|PROTEIN

MVVLSKLLLEESSSTSSTHVHSSSTHGHSSLTNMPSYDVYLSFRDLDTRHSFIYDLYEALIDANITTFLDDEEIETEEDLKPELESAIKASRAFIIVLSKNYASSTRCLDELVLILEQRMVSNHIIIPIFYHVEPTHVRNQQGSFGDAMAKHKQTMEVEIDANERSQWAVKMGRWNKALIEVANLKGKDVKGRRETEFIEEIVKDIHRRLHVPLRTLRTQLIGMESSIKFITSWLKDGSSHRADILTILGIGGIGKTSLA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_033809`
TK1151 ID	TkAUNG046470
OH-1004 ID	LXL04_033809
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	96.800
Protein coverage (%)	TK1151 98.473 / OH-1004 79.233 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_033809

Location Chr07:58921519-58926948 (+)

Description Similar to RUN1: Disease resistance protein RUN1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g63880`	TIR-NB-LRR receptor-like protein that confers resistance to the pathogen Leptosphaeria maculans (blackleg disease).	Transgressive segregation reveals two Arabidopsis TIR-NB-LRR resistance genes effective against Leptosphaeria maculans, causal agent of blackleg disease.2006 · DOI: 10.1111/j.1365-313x.2006.02688.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033809 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0007165 signal transduction Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0019677 NAD+ catabolic process Biological Process

GO:0043068 positive regulation of programmed cell death Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0003953 NAD+ nucleosidase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0042803 protein homodimerization activity Molecular Function

GO:0043531 ADP binding Molecular Function

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.382

Rank 1 · LXL04_033809 · OH-1004

Cell membrane0.343

Rank 2 · LXL04_033809 · OH-1004

Nucleus0.337

Rank 3 · LXL04_033809 · OH-1004

Endoplasmic reticulum0.080

Rank 4 · LXL04_033809 · OH-1004

Plastid0.040

Rank 5 · LXL04_033809 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01582.26TIR37-211 aa

PF13676.12TIR_239-135 aa

PF00931.29NB-ARC227-372 aa

PF23282.2WHD_ROQ1474-544 aa

PF12799.14LRR_4833-871 aa

PF20160.5C-JID974-1107 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_033809	`PF01582.26`	TIR	37	211	1.3e-42	146.4
LXL04_033809	`PF13676.12`	TIR_2	39	135	4.6e-14	53.7
LXL04_033809	`PF00931.29`	NB-ARC	227	372	5.4e-14	52.9
LXL04_033809	`PF23282.2`	WHD_ROQ1	474	544	4.1e-17	62.8
LXL04_033809	`PF12799.14`	LRR_4	833	871	8.9e-09	36.0
LXL04_033809	`PF20160.5`	C-JID	974	1107	2.1e-08	35.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9CAK1`	Arabidopsis thaliana	Disease resistance protein RML1B	28.345%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card