LXL04_033574 | RubberDandelionOmics

Gene overview

LXL04_033574

Reference: OH-1004 Chr: Chr07 Coordinates: 47905823-47906887 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1065 bp · LXL04_033574|LXL04_033574|OH1004|cDNA

ATGGACATCTCCACCTCTCCGCCACCGCTCCTCACCACCGCCGGTACCACCGACTCCACTATTTCTCAACTTTACAACAATGGCGGTGCTGCGTCTAATGATTATACATCACAACAACAGCGACACTCCGCTTCTTCATCCACGTCATCGACATCTTCCTCTATAATCATTGTGATAATTGTTATTGCTTCCGCTATCATCGTCTCCGCCTCTATTTATCTCCTCCTACGCTTTATCTCACGCCGCTGCAGCCGTACCGT...

CDS

Download CDS FASTA

1065 bp · LXL04_033574|LXL04_033574|OH1004|CDS

ATGGACATCTCCACCTCTCCGCCACCGCTCCTCACCACCGCCGGTACCACCGACTCCACTATTTCTCAACTTTACAACAATGGCGGTGCTGCGTCTAATGATTATACATCACAACAACAGCGACACTCCGCTTCTTCATCCACGTCATCGACATCTTCCTCTATAATCATTGTGATAATTGTTATTGCTTCCGCTATCATCGTCTCCGCCTCTATTTATCTCCTCCTACGCTTTATCTCACGCCGCTGCAGCCGTACCGT...

Protein

Download Protein FASTA

354 aa · LXL04_033574|LXL04_033574|OH1004|PROTEIN

MDISTSPPPLLTTAGTTDSTISQLYNNGGAASNDYTSQQQRHSASSSTSSTSSSIIIVIIVIASAIIVSASIYLLLRFISRRCSRTVTSFSTAENAVSDSRNENETHHHVICIDNDGVESLPLFTFSSLTGNIAGGDCAVCLSKFEAVDQLRLLPLCCHAFHVECIDAWLKSNQTCPLCRSTVNPTEADVLSKVLSVSDRTGARGGENRNNSFRIEIGSISRRQTPSDSGRRSYSIGSYEYILDDGYEVPVESTHRREIS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_033574`
TK1151 ID	TkA08G275140
OH-1004 ID	LXL04_033574
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 83.140 / OH-1004 80.791 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_033574

Location Chr07:47905823-47906887 (+)

Description Similar to ATL4: E3 ubiquitin-protein ligase ATL4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g60220`	E3 ubiquitin-protein ligase able to catalyze polyubiquitination with ubiquitin-conjugating enzyme E2 UBC8 in vitro.	No verified direct reference in this release
`At5g40250`	RING-H2 finger protein ATL46.	No verified direct reference in this release
`At1g23980`	RING-H2 finger protein ATL47.	No verified direct reference in this release
`At4g28890`	E3 ubiquitin-protein ligase able to catalyze polyubiquitination with ubiquitin-conjugating enzyme E2 UBC8 in vitro.	No verified direct reference in this release
`At5g57750`	Putative RING-H2 finger protein ATL50.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033574 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0016567 protein ubiquitination Biological Process

GO:0005634 nucleus Cellular Component

GO:0016020 membrane Cellular Component

GO:0004842 ubiquitin-protein transferase activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0061630 ubiquitin protein ligase activity Molecular Function

KEGG gene cross-reference

ath:AT1G23980

ath:AT3G60220

ath:AT4G28890

ath:AT5G40250

ath:AT5G57750

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.386

Rank 1 · LXL04_033574 · OH-1004

Nucleus0.249

Rank 2 · LXL04_033574 · OH-1004

Cytoplasm0.223

Rank 3 · LXL04_033574 · OH-1004

Endoplasmic reticulum0.159

Rank 4 · LXL04_033574 · OH-1004

Lysosome / Vacuole0.127

Rank 5 · LXL04_033574 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13639.13zf-RING_2137-180 aa

PF17123.12zf-RING_11137-166 aa

PF13923.13zf-C3HC4_2138-179 aa

PF12678.14zf-rbx1156-180 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_033574	`PF13639.13`	zf-RING_2	137	180	6.5e-14	52.6
LXL04_033574	`PF17123.12`	zf-RING_11	137	166	1.1e-08	35.3
LXL04_033574	`PF13923.13`	zf-C3HC4_2	138	179	9.5e-06	26.0
LXL04_033574	`PF12678.14`	zf-rbx1	156	180	1.3e-07	32.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LY41`	Arabidopsis thaliana	E3 ubiquitin-protein ligase ATL4	55.242%	Swiss-Prot	moderate database homology
`Q9FL07`	Arabidopsis thaliana	RING-H2 finger protein ATL46	28.870%	Swiss-Prot	weak database homology
`Q8GW38`	Arabidopsis thaliana	RING-H2 finger protein ATL47	32.759%	Swiss-Prot	moderate database homology
`Q5XF85`	Arabidopsis thaliana	E3 ubiquitin-protein ligase ATL42	60.000%	Swiss-Prot	weak database homology
`Q9FHG8`	Arabidopsis thaliana	Putative RING-H2 finger protein ATL50	41.667%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card