LXL04_033547 | RubberDandelionOmics

Gene overview

LXL04_033547

Reference: OH-1004 Chr: Chr07 Coordinates: 47427545-47430746 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

873 bp · LXL04_033547|LXL04_033547|OH1004|cDNA

ATGTTGATGCAGTTGCTTAGGGAGATATCCCATGATAACGTGGTAAAGCTGGTGAATGTGCACATCAATCATATTGACATGTCACTCTATCTGGCTTTTGATTATGCAGAGCACGACCTTTATGAAATTATCAGACATCATAGAGACAAGGTCAACCAAGCTATCAACCAATACACAGTGAAGTCAATACTTTGGCAGTTGCTTAATGGGCTAAATTATCTTCATAAGGTTATGGGTGATGGAGAAGAACAAGGAATTGT...

CDS

Download CDS FASTA

873 bp · LXL04_033547|LXL04_033547|OH1004|CDS

ATGTTGATGCAGTTGCTTAGGGAGATATCCCATGATAACGTGGTAAAGCTGGTGAATGTGCACATCAATCATATTGACATGTCACTCTATCTGGCTTTTGATTATGCAGAGCACGACCTTTATGAAATTATCAGACATCATAGAGACAAGGTCAACCAAGCTATCAACCAATACACAGTGAAGTCAATACTTTGGCAGTTGCTTAATGGGCTAAATTATCTTCATAAGGTTATGGGTGATGGAGAAGAACAAGGAATTGT...

Protein

Download Protein FASTA

290 aa · LXL04_033547|LXL04_033547|OH1004|PROTEIN

MLMQLLREISHDNVVKLVNVHINHIDMSLYLAFDYAEHDLYEIIRHHRDKVNQAINQYTVKSILWQLLNGLNYLHKVMGDGEEQGIVKIADFGLARIYQAPLKPLFDNGVVVTIWYRAPELLLGGKHYTSAVDMWAVGCIFAELLTLKPLFQGQEVKATPNPFQACSTTGSVDIALGLHILESFPNMVENVQVSMGTKTRGNAFVALSHCGFRIQVAVNNKVLSWTPTTASSTATSFSDGFSMPDNIRSAVVSLSINTAV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_033547`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_033547

Location Chr07:47427545-47430746 (-)

Description Similar to CDKE-1: Cyclin-dependent kinase E-1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g63610`	Involved in cell differentiation.	HUA ENHANCER3 reveals a role for a cyclin-dependent protein kinase in the specification of floral organ identity in Arabidopsis.2004 · DOI: 10.1242/dev.01187

Rice

Reference gene ID	Possible function	Papers / DOI
`Os10g0580300`	Cyclin-dependent kinase E-1.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033547 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000082 G1/S transition of mitotic cell cycle Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006468 protein phosphorylation Biological Process

GO:0010344 seed oilbody biogenesis Biological Process

GO:0010628 positive regulation of gene expression Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0034472 snRNA 3'-end processing Biological Process

GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process

GO:0050821 protein stabilization Biological Process

GO:0051301 cell division Biological Process

GO:0090209 negative regulation of triglyceride metabolic process Biological Process

GO:0000151 ubiquitin ligase complex Cellular Component

KEGG gene cross-reference

ath:AT5G63610

ddi:DDB_G0267442

dme:Dmel_CG10572

dosa:Os10g0580300

mmu:264064

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.492

Rank 1 · LXL04_033547 · OH-1004

Nucleus0.313

Rank 2 · LXL04_033547 · OH-1004

Mitochondrion0.126

Rank 3 · LXL04_033547 · OH-1004

Endoplasmic reticulum0.087

Rank 4 · LXL04_033547 · OH-1004

Cell membrane0.079

Rank 5 · LXL04_033547 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase4-158 aa

PF07714.24PK_Tyr_Ser-Thr83-147 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_033547	`PF00069.32`	Pkinase	4	158	1e-29	104.5
LXL04_033547	`PF07714.24`	PK_Tyr_Ser-Thr	83	147	1.4e-13	51.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84TI6`	Arabidopsis thaliana	Cyclin-dependent kinase E-1	73.232%	Swiss-Prot	moderate database homology
`Q336M2`	Oryza sativa subsp. japonica	Cyclin-dependent kinase E-1	74.242%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card