LXL04_033271 | RubberDandelionOmics

Gene overview

LXL04_033271

Reference: OH-1004 Chr: Chr07 Coordinates: 40005740-40017149 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5931 bp · LXL04_033271|LXL04_033271|OH1004|cDNA

GATCATGAATTTCAATGACATTACAATGATATCCGACTTAAATCCAAATATGGAGGATTATACACTCAAGGTTAGAATTATCCGTATTTGGAAATTCACTTCATGGGTAAATCCAAACGATGTTCGTGGTTTTGGGATGGTATTAATTGATGAGAAGGGTGATAGGATTGAATGTAATGTTGATAGACCTCATAACATAAAATGGGACAAAGTTCTTGACGAATATGGAGCTTTTTATATTCACAACCCAACACTTGGTG...

CDS

Download CDS FASTA

5907 bp · LXL04_033271|LXL04_033271|OH1004|CDS

ATGAATTTCAATGACATTACAATGATATCCGACTTAAATCCAAATATGGAGGATTATACACTCAAGGTTAGAATTATCCGTATTTGGAAATTCACTTCATGGGTAAATCCAAACGATGTTCGTGGTTTTGGGATGGTATTAATTGATGAGAAGGGTGATAGGATTGAATGTAATGTTGATAGACCTCATAACATAAAATGGGACAAAGTTCTTGACGAATATGGAGCTTTTTATATTCACAACCCAACACTTGGTGTCAA...

Protein

Download Protein FASTA

1968 aa · LXL04_033271|LXL04_033271|OH1004|PROTEIN

MNFNDITMISDLNPNMEDYTLKVRIIRIWKFTSWVNPNDVRGFGMVLIDEKGDRIECNVDRPHNIKWDKVLDEYGAFYIHNPTLGVNQASTKYADGRNKLFFIYNTTVDKCKSFDGPINSFKFVDFQTILDNGVQTDLTIDLIGDVVQVYELETHAGPNKNTLKQTLVMEDLRGLKVFVTLWGDYASEVVNYISTHADISCLIMIIQFGRLKFFGGRVYVNNTMAATKLFINKDIEEIREFKKELLSIKGYDTASSTRTI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_033271`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_033271

Location Chr07:40005740-40017149 (+)

Description Similar to Pif1: ATP-dependent DNA helicase PIF1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0776800`	Component of the replication protein A complex (RPA) required for DNA recombination, repair and replication.	Two types of replication protein A in seed plants.2005 · DOI: 10.1111/j.1742-4658.2005.04719.x Replication protein A (RPA1a) is required for meiotic and somatic DNA repair but is dispensable for DNA replication and homologous recombination in rice.2009 · DOI: 10.1104/pp.109.142877

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033271 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000722 telomere maintenance via recombination Biological Process

GO:0000723 telomere maintenance Biological Process

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0000727 double-strand break repair via break-induced replication Biological Process

GO:0001117 protein-DNA-RNA complex disassembly Biological Process

GO:0006260 DNA replication Biological Process

GO:0006281 DNA repair Biological Process

GO:0006289 nucleotide-excision repair Biological Process

GO:0006310 DNA recombination Biological Process

GO:0007004 telomere maintenance via telomerase Biological Process

GO:0007140 male meiotic nuclear division Biological Process

GO:0009555 pollen development Biological Process

KEGG gene cross-reference

cal:CAALFM_CR07360WA

dosa:Os02g0776800

hsa:80119

mmu:208084

rno:367645

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.937

Rank 1 · LXL04_033271 · OH-1004

Cytoplasm0.137

Rank 2 · LXL04_033271 · OH-1004

Mitochondrion0.034

Rank 3 · LXL04_033271 · OH-1004

Cell membrane0.014

Rank 4 · LXL04_033271 · OH-1004

Extracellular0.008

Rank 5 · LXL04_033271 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02721.22DUF22310-131 aa

PF14214.12Helitron_like_N976-1156 aa

PF23343.3REP_ORF2-G2P1082-1170 aa

PF05970.21PIF11617-1685 aa

PF21530.4Pif1_2B_dom1791-1835 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_033271	`PF02721.22`	DUF223	10	131	7e-13	49.5
LXL04_033271	`PF14214.12`	Helitron_like_N	976	1156	2.6e-58	198.1
LXL04_033271	`PF23343.3`	REP_ORF2-G2P	1082	1170	6.4e-06	27.1
LXL04_033271	`PF05970.21`	PIF1	1617	1685	3.2e-26	93.0
LXL04_033271	`PF21530.4`	Pif1_2B_dom	1791	1835	1.9e-17	63.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6YZ49`	Oryza sativa subsp. japonica	Replication protein A 70 kDa DNA-binding subunit A	24.433%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card