LXL04_033243 | RubberDandelionOmics

Gene overview

LXL04_033243

Reference: OH-1004 Chr: Chr07 Coordinates: 39109787-39114406 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2196 bp · LXL04_033243|LXL04_033243|OH1004|cDNA

atGATAGTACGTGGAGGTTTGCTGAATCCTTTGTTTCACGCTCCTTCAGTGTCCGATTCGATGTCGATTGCAATTACTTCAACGAACTGTATCGTCTCACCGTCTTACCGTCGGCAACAGTACGTCAACGCCGGCAATGTGCTTTTTCATAGCAAAAAGGTCACGCGAGATCGTGTCAGTTTGAGTCATCGAATTCGAGCTTATTCCGAATCTAAGACAGAAGAAAAGCAAGTAAGAAAGTATTCACCCCTTCTTGAGAG...

CDS

Download CDS FASTA

2196 bp · LXL04_033243|LXL04_033243|OH1004|CDS

ATGATAGTACGTGGAGGTTTGCTGAATCCTTTGTTTCACGCTCCTTCAGTGTCCGATTCGATGTCGATTGCAATTACTTCAACGAACTGTATCGTCTCACCGTCTTACCGTCGGCAACAGTACGTCAACGCCGGCAATGTGCTTTTTCATAGCAAAAAGGTCACGCGAGATCGTGTCAGTTTGAGTCATCGAATTCGAGCTTATTCCGAATCTAAGACAGAAGAAAAGCAAGTAAGAAAGTATTCACCCCTTCTTGAGAG...

Protein

Download Protein FASTA

731 aa · LXL04_033243|LXL04_033243|OH1004|PROTEIN

MIVRGGLLNPLFHAPSVSDSMSIAITSTNCIVSPSYRRQQYVNAGNVLFHSKKVTRDRVSLSHRIRAYSESKTEEKQVRKYSPLLESHEVSENNVSTAEFKAIPDIWRSSAQKFGDRVALVDPHHDPPTNMTYNQVEQDILHFSEGLRVIGMKPCEKLALFADNSCRWLIADQGIMATGAINVVRGSRSSVEELLHIYTHSESVALVVDNPELYHRIATGFNSKASVRFVILLWGDKSSLSSQNMEGIPVYSYKDIIDLG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_033243`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_033243

Location Chr07:39109787-39114406 (+)

Description Similar to AAE15: Long-chain-fatty-acid--[acyl-carrier-protein] ligase AEE15, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g14070`	Probably involved in the activation of fatty acids to acyl- carrier-protein prior to fatty acid elongation in plastids.	Identification of a plastid acyl-acyl carrier protein synthetase in Arabidopsis and its role in the activation and elongation of exogenous fatty acids.2005 · DOI: 10.1111/j.1365-313x.2005.02553.x
`At3g23790`	May be involved in the activation of fatty acids to acyl-carrier-protein.	No verified direct reference in this release
`At2g47240`	Activation of long-chain fatty acids for both synthesis of cellular lipids, and degradation via beta-oxidation.	Leaf Epicuticular Waxes of the Eceriferum Mutants in Arabidopsis.1995 · DOI: 10.1104/pp.108.1.369 Arabidopsis CER8 encodes LONG-CHAIN ACYL-COA SYNTHETASE 1 (LACS1) that has overlapping functions with LACS2 in plant wax and cutin synthesis.2009 · DOI: 10.1111/j.1365-313x.2009.03892.x Organ fusion and defective cuticle function in a lacs1 lacs2 double mutant of Arabidopsis.2010 · DOI: 10.1007/s00425-010-1110-4
`At5g27600`	Activation of long-chain fatty acids for both synthesis of cellular lipids, and degradation via beta-oxidation (Probable).	Two long-chain acyl-CoA synthetases from Arabidopsis thaliana involved in peroxisomal fatty acid beta-oxidation.2002 · DOI: 10.1046/j.1365-313x.2002.01405.x Peroxisomal Acyl-CoA synthetase activity is essential for seedling development in Arabidopsis thaliana.2004 · DOI: 10.1105/tpc.019646 Analysis of the role of COMATOSE and peroxisomal beta-oxidation in the determination of germination potential in Arabidopsis.2006 · DOI: 10.1093/jxb/erl045

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033243 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006631 fatty acid metabolic process Biological Process

GO:0006633 fatty acid biosynthetic process Biological Process

GO:0009651 response to salt stress Biological Process

GO:0010025 wax biosynthetic process Biological Process

GO:0010143 cutin biosynthetic process Biological Process

GO:0010193 response to ozone Biological Process

GO:0030497 fatty acid elongation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

KEGG gene cross-reference

ath:AT2G47240

ath:AT3G23790

ath:AT4G14070

ath:AT5G27600

mmi:MMAR_3231

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.741

Rank 1 · LXL04_033243 · OH-1004

Cytoplasm0.092

Rank 2 · LXL04_033243 · OH-1004

Plastid0.087

Rank 3 · LXL04_033243 · OH-1004

Peroxisome0.079

Rank 4 · LXL04_033243 · OH-1004

Endoplasmic reticulum0.050

Rank 5 · LXL04_033243 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00501.35AMP-binding109-564 aa

PF23562.3AMP-binding_C_3612-731 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_033243	`PF00501.35`	AMP-binding	109	564	5e-76	256.7
LXL04_033243	`PF23562.3`	AMP-binding_C_3	612	731	3.2e-14	54.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8W471`	Arabidopsis thaliana	Long-chain-fatty-acid--[acyl-carrier-protein] ligase AEE15, chloroplastic	67.308%	Swiss-Prot	strong database homology
`Q9LK39`	Arabidopsis thaliana	Probable acyl-activating enzyme 16, chloroplastic	62.775%	Swiss-Prot	strong database homology
`O22898`	Arabidopsis thaliana	Long chain acyl-CoA synthetase 1	26.677%	Swiss-Prot	weak database homology
`Q8LKS5`	Arabidopsis thaliana	Long chain acyl-CoA synthetase 7, peroxisomal	26.341%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card