LXL04_033157 | RubberDandelionOmics

Gene overview

LXL04_033157

Reference: OH-1004 Chr: Chr07 Coordinates: 37324333-37327393 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1374 bp · LXL04_033157|LXL04_033157|OH1004|cDNA

ATGGAGTGGCGAAAGGtgagagagatgaGGGAGATCATAAGCATACACATAGGTCAAGCCGGAATTCAGGTTGGGAATTCATGTTGGGAGCTTTACTGCCTCGAACATGGCATTCAGCCCGATGGTTTGATGCCTAGTGACACCACACCAGGGGTTGCAGATGATGCATTCAACACCTTCTTCAGTGAAACCGGTGCAGGAAAGCATGTCCCAAGAGCAATATTCGTTGACCTTGAACCAACAGTCATCGATGAAGTCAG...

CDS

Download CDS FASTA

1374 bp · LXL04_033157|LXL04_033157|OH1004|CDS

ATGGAGTGGCGAAAGGTGAGAGAGATGAGGGAGATCATAAGCATACACATAGGTCAAGCCGGAATTCAGGTTGGGAATTCATGTTGGGAGCTTTACTGCCTCGAACATGGCATTCAGCCCGATGGTTTGATGCCTAGTGACACCACACCAGGGGTTGCAGATGATGCATTCAACACCTTCTTCAGTGAAACCGGTGCAGGAAAGCATGTCCCAAGAGCAATATTCGTTGACCTTGAACCAACAGTCATCGATGAAGTCAG...

Protein

Download Protein FASTA

457 aa · LXL04_033157|LXL04_033157|OH1004|PROTEIN

MEWRKVREMREIISIHIGQAGIQVGNSCWELYCLEHGIQPDGLMPSDTTPGVADDAFNTFFSETGAGKHVPRAIFVDLEPTVIDEVRTGTYRQLFHPEQLISGKEDAANNFARGHYTVGKEIVDLCLDRIRKLADNCTGLQGFLAFNAVGGGTGSGLGSLLLERLSVDYGKKSKLGFTIYPSPQVSTAVVEPYNSVLSTHALLEHTDVAVLLDNEAIYDICRKSLDIERPTYTNLNRLISQTISSLTTSLRFDGAINVDI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_033157`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_033157

Location Chr07:37324333-37327393 (-)

Description Similar to TUBA5: Tubulin alpha-5 chain

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g19780`	Tubulin is the major constituent of microtubules, a cylinder consisting of laterally associated linear protofilaments composed of alpha- and beta-tubulin heterodimers.	No verified direct reference in this release
`At5g19770`	Tubulin is the major constituent of microtubules, a cylinder consisting of laterally associated linear protofilaments composed of alpha- and beta-tubulin heterodimers.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0574800`	Tubulin is the major constituent of microtubules, a cylinder consisting of laterally associated linear protofilaments composed of alpha- and beta-tubulin heterodimers.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033157 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000226 microtubule cytoskeleton organization Biological Process

GO:0000278 mitotic cell cycle Biological Process

GO:0007017 microtubule-based process Biological Process

GO:0071258 cellular response to gravity Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005874 microtubule Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009536 plastid Cellular Component

KEGG gene cross-reference

ath:AT5G19770

ath:AT5G19780

zma:542582

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.760

Rank 1 · LXL04_033157 · OH-1004

Mitochondrion0.149

Rank 2 · LXL04_033157 · OH-1004

Nucleus0.101

Rank 3 · LXL04_033157 · OH-1004

Peroxisome0.034

Rank 4 · LXL04_033157 · OH-1004

Cell membrane0.030

Rank 5 · LXL04_033157 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00091.32Tubulin11-221 aa

PF03953.23Tubulin_C271-400 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_033157	`PF00091.32`	Tubulin	11	221	5.5e-62	210.2
LXL04_033157	`PF03953.23`	Tubulin_C	271	400	1.7e-51	174.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`B9DHQ0`	Arabidopsis thaliana	Tubulin alpha-5 chain	95.991%	Swiss-Prot	strong database homology
`Q56WH1`	Arabidopsis thaliana	Tubulin alpha-3 chain	95.991%	Swiss-Prot	strong database homology
`P28752`	Oryza sativa subsp. japonica	Tubulin alpha-1 chain	95.778%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card