LXL04_033101 | RubberDandelionOmics

Gene overview

LXL04_033101

Reference: OH-1004 Chr: Chr07 Coordinates: 35946689-35952051 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2568 bp · LXL04_033101|LXL04_033101|OH1004|cDNA

atgaaaattttaacaaaacaaaaaagaaTGAACCCACCCCCAAATTGCAAGAGCGAAGAGAGATCCATCACATTCAGCACACACAGAGAAGAGAAGATGGAAGCACAAGCTGGGCAACAACAATGGATGATGAGCGCACAAGCACAGCCGCAATATGCTTACGGAGCGCCGCCGCCGCCTCCGCCACAACACTACCACCAGCCTTCCTCCCATGAAGAAATCCGTACCCTATGGATTGGCGATTTACCCTACTGGGCTGA...

CDS

Download CDS FASTA

2568 bp · LXL04_033101|LXL04_033101|OH1004|CDS

ATGAAAATTTTAACAAAACAAAAAAGAATGAACCCACCCCCAAATTGCAAGAGCGAAGAGAGATCCATCACATTCAGCACACACAGAGAAGAGAAGATGGAAGCACAAGCTGGGCAACAACAATGGATGATGAGCGCACAAGCACAGCCGCAATATGCTTACGGAGCGCCGCCGCCGCCTCCGCCACAACACTACCACCAGCCTTCCTCCCATGAAGAAATCCGTACCCTATGGATTGGCGATTTACCCTACTGGGCTGA...

Protein

Download Protein FASTA

855 aa · LXL04_033101|LXL04_033101|OH1004|PROTEIN

MKILTKQKRMNPPPNCKSEERSITFSTHREEKMEAQAGQQQWMMSAQAQPQYAYGAPPPPPPQHYHQPSSHEEIRTLWIGDLPYWADESYLHSWFAATTEVLSIKVIRNKATGISEGYGFLEFASHSTAERALRSYNGTQIPGTELTFWLNWASSGIGERRPDAGPEHSYAYKFGYSEAGTFSYYDYCDDYPIYDQTMGINEYTRQLDVTQRTTSEHTRQNEQLSSSFRANPPDCLESNHDTGESLHVWEDNVDLDNMTY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_033101`
TK1151 ID	TkA08G230560
OH-1004 ID	LXL04_033101
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	94.500
Protein coverage (%)	TK1151 100.000 / OH-1004 55.673 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_033101

Location Chr07:35946689-35952051 (+)

Description Similar to RBP47B': Polyadenylate-binding protein RBP47B'

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g19350`	Heterogeneous nuclear ribonucleoprotein (hnRNP)-protein binding the poly(A) tail of mRNA and probably involved in some steps of pre-mRNA maturation.	No verified direct reference in this release
`At1g11650`	Heterogeneous nuclear ribonucleoprotein (hnRNP)-protein binding the poly(A) tail of mRNA and probably involved in some steps of pre-mRNA maturation.	Phylogenetic and expression analysis of RNA-binding proteins with triple RNA recognition motifs in plants.2011 · DOI: 10.1007/s10059-011-0001-2
`At1g47490`	Heterogeneous nuclear ribonucleoprotein (hnRNP)-protein binding the poly(A) tail of mRNA and probably involved in some steps of pre-mRNA maturation.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033101 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0006397 mRNA processing Biological Process

GO:0010193 response to ozone Biological Process

GO:0031047 regulatory ncRNA-mediated gene silencing Biological Process

GO:0034605 cellular response to heat Biological Process

GO:0048573 photoperiodism, flowering Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005685 U1 snRNP Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0010494 cytoplasmic stress granule Cellular Component

KEGG gene cross-reference

ath:AT1G11650

ath:AT5G19350

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.568

Rank 1 · LXL04_033101 · OH-1004

Cytoplasm0.559

Rank 2 · LXL04_033101 · OH-1004

Cell membrane0.063

Rank 3 · LXL04_033101 · OH-1004

Endoplasmic reticulum0.048

Rank 4 · LXL04_033101 · OH-1004

Mitochondrion0.039

Rank 5 · LXL04_033101 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00076.29RRM_177-146 aa

PF12678.14zf-rbx1304-349 aa

PF13639.13zf-RING_2308-349 aa

PF13923.13zf-C3HC4_2308-349 aa

PF17123.12zf-RING_11309-335 aa

PF00076.29RRM_1456-525 aa

PF00076.29RRM_1549-617 aa

PF00076.29RRM_1661-722 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_033101	`PF00076.29`	RRM_1	77	146	7.1e-69	228.4
LXL04_033101	`PF12678.14`	zf-rbx1	304	349	1.5e-06	29.0
LXL04_033101	`PF13639.13`	zf-RING_2	308	349	4.2e-12	46.8
LXL04_033101	`PF13923.13`	zf-C3HC4_2	308	349	5e-07	30.1
LXL04_033101	`PF17123.12`	zf-RING_11	309	335	1.9e-06	28.2
LXL04_033101	`PF00076.29`	RRM_1	456	525	7.1e-69	228.4
LXL04_033101	`PF00076.29`	RRM_1	549	617	7.1e-69	228.4
LXL04_033101	`PF00076.29`	RRM_1	661	722	7.1e-69	228.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VXZ9`	Arabidopsis thaliana	Polyadenylate-binding protein RBP47B'	64.965%	Swiss-Prot	weak database homology
`Q9SAB3`	Arabidopsis thaliana	Polyadenylate-binding protein RBP45B	52.825%	Swiss-Prot	weak database homology
`Q9SX79`	Arabidopsis thaliana	Polyadenylate-binding protein RBP47C	50.663%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card