LXL04_033088 | RubberDandelionOmics

Gene overview

LXL04_033088

Reference: OH-1004 Chr: Chr07 Coordinates: 35703725-35706415 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

756 bp · LXL04_033088|LXL04_033088|OH1004|cDNA

ATGTCTGGCCAGAGCCAGCGTTTGAACGTTGTCCCAACAGTCACCGTCCTTGGTGTTGTCAAAGCTCGTCTCATTGGTGCAACCAGAGGCCACGCTCTTCTCAAGAAAAAAAGCGATGCTCTAACAGTCCAATTCCGAGCCATCCTAAAAAAAATCGTCTCCACAAAAGAATCAATGGGAGAAGTAATGAAAACCTCCTCCTTCGCTCTAACAGAAGCCAAATACGTTGCAGGAGAAAACATCAAATTCACAGTCATAGA...

CDS

Download CDS FASTA

756 bp · LXL04_033088|LXL04_033088|OH1004|CDS

ATGTCTGGCCAGAGCCAGCGTTTGAACGTTGTCCCAACAGTCACCGTCCTTGGTGTTGTCAAAGCTCGTCTCATTGGTGCAACCAGAGGCCACGCTCTTCTCAAGAAAAAAAGCGATGCTCTAACAGTCCAATTCCGAGCCATCCTAAAAAAAATCGTCTCCACAAAAGAATCAATGGGAGAAGTAATGAAAACCTCCTCCTTCGCTCTAACAGAAGCCAAATACGTTGCAGGAGAAAACATCAAATTCACAGTCATAGA...

Protein

Download Protein FASTA

251 aa · LXL04_033088|LXL04_033088|OH1004|PROTEIN

MSGQSQRLNVVPTVTVLGVVKARLIGATRGHALLKKKSDALTVQFRAILKKIVSTKESMGEVMKTSSFALTEAKYVAGENIKFTVIENVKTASLRVKSRTENIAGVKLPKFDYFTESETKNELTGLARGGQQVQGCKVAYVKAIEVLVELASLQTSFLTLDEAIKTTNRRVNALESVVKPRLENTITYIKGELDELEREDFFRLKKIQGFKKREVENKRKAALEFRELQAAEHLSLEKGIPITAAHDMLAI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_033088`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_033088

Location Chr07:35703725-35706415 (-)

Description Similar to VHA-D: V-type proton ATPase subunit D

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g58730`	Subunit of the peripheral V1 complex of vacuolar ATPase.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033088 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007035 vacuolar acidification Biological Process

GO:0007042 lysosomal lumen acidification Biological Process

GO:0016241 regulation of macroautophagy Biological Process

GO:0048388 endosomal lumen acidification Biological Process

GO:0051452 intracellular pH reduction Biological Process

GO:0060271 cilium assembly Biological Process

GO:0061512 protein localization to cilium Biological Process

GO:0061795 Golgi lumen acidification Biological Process

GO:1902600 proton transmembrane transport Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0000221 vacuolar proton-transporting V-type ATPase, V1 domain Cellular Component

GO:0000325 plant-type vacuole Cellular Component

KEGG gene cross-reference

ath:AT3G58730

cal:CAALFM_C406400CA

hsa:51382

ocu:100009221

pon:100172107

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.651

Rank 1 · LXL04_033088 · OH-1004

Cell membrane0.171

Rank 2 · LXL04_033088 · OH-1004

Nucleus0.139

Rank 3 · LXL04_033088 · OH-1004

Lysosome / Vacuole0.131

Rank 4 · LXL04_033088 · OH-1004

Golgi apparatus0.094

Rank 5 · LXL04_033088 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01813.23ATP-synt_D18-208 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_033088	`PF01813.23`	ATP-synt_D	18	208	1.7e-66	224.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9XGM1`	Arabidopsis thaliana	V-type proton ATPase subunit D	78.313%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card