LXL04_032851 | RubberDandelionOmics

Gene overview

LXL04_032851

Reference: OH-1004 Chr: Chr07 Coordinates: 30474280-30474914 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

570 bp · LXL04_032851|LXL04_032851|OH1004|cDNA

ATGTTCAATAATGCAGGGGTACTGGCAGATACTTCCAAGCCCCGCATTATGGACATGGATAAAAAGGACATCGAGTGTGTGCTTGGTGTCAATGTCATAGGAACCTTTTCGTGCATGAAACACGCAGCCCGAGTTATGGTCCCACAAAAAGCGGGCTCTATAATATCAACATCTGGTCTTACTTCACATCTTGGTGGTATGGCCACTCACGGTTATTCGTGTTCAAAACACGCGATAATTGGTCTAACCAGGAATCTTGC...

CDS

Download CDS FASTA

570 bp · LXL04_032851|LXL04_032851|OH1004|CDS

ATGTTCAATAATGCAGGGGTACTGGCAGATACTTCCAAGCCCCGCATTATGGACATGGATAAAAAGGACATCGAGTGTGTGCTTGGTGTCAATGTCATAGGAACCTTTTCGTGCATGAAACACGCAGCCCGAGTTATGGTCCCACAAAAAGCGGGCTCTATAATATCAACATCTGGTCTTACTTCACATCTTGGTGGTATGGCCACTCACGGTTATTCGTGTTCAAAACACGCGATAATTGGTCTAACCAGGAATCTTGC...

Protein

Download Protein FASTA

189 aa · LXL04_032851|LXL04_032851|OH1004|PROTEIN

MFNNAGVLADTSKPRIMDMDKKDIECVLGVNVIGTFSCMKHAARVMVPQKAGSIISTSGLTSHLGGMATHGYSCSKHAIIGLTRNLAVELGQFGIRVNFVPSFGIATSMSTDFIGIEREVFEHLMNGVANLKGVTHKAKDVAYAALYLASDEAKYVSGQNMHVDGGLSYANDSFKMYQIITKENDRLQG

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032851`
TK1151 ID	TkA08G209260
OH-1004 ID	LXL04_032851
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032851

Location Chr07:30474280-30474914 (-)

Description Similar to Secoisolariciresinol dehydrogenase (Fragment)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0179200`	Involved in momilactone phytoalexins biosynthesis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032851 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009807 lignan biosynthetic process Biological Process

GO:0016114 terpenoid biosynthetic process Biological Process

GO:0004022 alcohol dehydrogenase (NAD+) activity Molecular Function

GO:0016491 oxidoreductase activity Molecular Function

GO:0102960 momilactone-A synthase [NAD(P)H] activity Molecular Function

GO:0120529 secoisolariciresinol dehydrogenase activity Molecular Function

KEGG gene cross-reference

dosa:Os04g0179200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.562

Rank 1 · LXL04_032851 · OH-1004

Peroxisome0.249

Rank 2 · LXL04_032851 · OH-1004

Nucleus0.189

Rank 3 · LXL04_032851 · OH-1004

Mitochondrion0.077

Rank 4 · LXL04_032851 · OH-1004

Lysosome / Vacuole0.031

Rank 5 · LXL04_032851 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13561.13adh_short_C21-168 aa

PF00106.32adh_short1-111 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032851	`PF13561.13`	adh_short_C2	1	168	1.6e-37	130.1
LXL04_032851	`PF00106.32`	adh_short	1	111	1.3e-23	84.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q7FAE1`	Oryza sativa subsp. japonica	Momilactone A synthase	51.381%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card