LXL04_032747 | RubberDandelionOmics

Gene overview

LXL04_032747

Reference: OH-1004 Chr: Chr07 Coordinates: 28965444-28967152 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1549 bp · LXL04_032747|LXL04_032747|OH1004|cDNA

AGTAGTGTGCACCGTGACATCCAACTGGAAACCCATTAATAGGAAAACAAACAATTCACACTCACAAATCGGACAGCGAAATCTGCACCAGATCTCTCCCGCAGATCCCAATTCCTAACGCCAAATTCTCCGGATCTTCGATATGGCGGCATCACGGCGTCTCCGGGACCTACAATCGCAGCCAGGCAACAAGACCTGCGTCGATTGCTCACAGAAGAATCCTCAGTGGGCCTCTGTATCCTACGGTATCTTCATGTGCT...

CDS

Download CDS FASTA

1407 bp · LXL04_032747|LXL04_032747|OH1004|CDS

ATGGCGGCATCACGGCGTCTCCGGGACCTACAATCGCAGCCAGGCAACAAGACCTGCGTCGATTGCTCACAGAAGAATCCTCAGTGGGCCTCTGTATCCTACGGTATCTTCATGTGCTTAGAGTGCTCGGGGAAGCACCGGGGTCTCGGTGTTCATATCTCCTTTGTCCGATCTGTCACCATGGACTCATGGTCTGAGATCCAACTCCGGAAAATGGAGTCCGGCGGCAACGAAAAGCTCAACAACTTCTTCTCGAAGTA...

Protein

Download Protein FASTA

468 aa · LXL04_032747|LXL04_032747|OH1004|PROTEIN

MAASRRLRDLQSQPGNKTCVDCSQKNPQWASVSYGIFMCLECSGKHRGLGVHISFVRSVTMDSWSEIQLRKMESGGNEKLNNFFSKYGIPKETDIISKYNTNAASVYRDRIQALAEGKSWQDPPIVKESSIKSGGSKKPPLSVGSGGRGGNSGGWDSDWGDSSFDERGVGSPDNMRRNQTVGNLRNGSSSGGMPARSRSTDDMYTRSQLEASAAGKEGFFAKKMQENESRPEGLPPSQGGKYVGFGSSPNPIPRPNPQGD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032747`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032747

Location Chr07:28965444-28967152 (+)

Description Similar to AGD7: ADP-ribosylation factor GTPase-activating protein AGD7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g37550`	GTPase-activating protein (GAP) for ADP ribosylation factor (ARF).	Overexpression of Arabidopsis AGD7 causes relocation of Golgi-localized proteins to the endoplasmic reticulum and inhibits protein trafficking in plant cells.2007 · DOI: 10.1104/pp.106.095091
`At3g53710`	GTPase-activating protein (GAP) for ADP ribosylation factor (ARF).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032747 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000278 mitotic cell cycle Biological Process

GO:0006888 endoplasmic reticulum to Golgi vesicle-mediated transport Biological Process

GO:0006890 retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum Biological Process

GO:0007015 actin filament organization Biological Process

GO:0015031 protein transport Biological Process

GO:0016192 vesicle-mediated transport Biological Process

GO:0030100 regulation of endocytosis Biological Process

GO:0032012 regulation of ARF protein signal transduction Biological Process

GO:0043001 Golgi to plasma membrane protein transport Biological Process

GO:0048205 COPI coating of Golgi vesicle Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT2G37550

ath:AT3G53710

hsa:55738

mmu:228998

sce:YDL226C

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.595

Rank 1 · LXL04_032747 · OH-1004

Cytoplasm0.328

Rank 2 · LXL04_032747 · OH-1004

Endoplasmic reticulum0.144

Rank 3 · LXL04_032747 · OH-1004

Nucleus0.090

Rank 4 · LXL04_032747 · OH-1004

Cell membrane0.080

Rank 5 · LXL04_032747 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01412.24ArfGap5-110 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032747	`PF01412.24`	ArfGap	5	110	2.4e-36	125.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O80925`	Arabidopsis thaliana	ADP-ribosylation factor GTPase-activating protein AGD7	61.169%	Swiss-Prot	strong database homology
`Q9M354`	Arabidopsis thaliana	Probable ADP-ribosylation factor GTPase-activating protein AGD6	59.916%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card