LXL04_032736 | RubberDandelionOmics

Gene overview

LXL04_032736

Reference: OH-1004 Chr: Chr07 Coordinates: 28711108-28713999 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1305 bp · LXL04_032736|LXL04_032736|OH1004|cDNA

ATGGAGACGCAGAGGATCTTGGAATTTCCTCACAAAAATATGGATAAGCGACCAAGGAAACGACCTCGATTGGCTTGGGACATGCCAGCTCCTGTTCCTCCTCCTCCAAAGGTACTCCCAGCTTTATACTGCAGGCAAGACTTTATAAACGGACCAGTCCCCAATTTTTCCTACTCTTCAATATATTACAAAGGGATACCCCACAATGGCTCCCCTCCATGGAGACCAGATGATAAAGAAGGCCACTACATTTTTGCAGT...

CDS

Download CDS FASTA

1305 bp · LXL04_032736|LXL04_032736|OH1004|CDS

ATGGAGACGCAGAGGATCTTGGAATTTCCTCACAAAAATATGGATAAGCGACCAAGGAAACGACCTCGATTGGCTTGGGACATGCCAGCTCCTGTTCCTCCTCCTCCAAAGGTACTCCCAGCTTTATACTGCAGGCAAGACTTTATAAACGGACCAGTCCCCAATTTTTCCTACTCTTCAATATATTACAAAGGGATACCCCACAATGGCTCCCCTCCATGGAGACCAGATGATAAAGAAGGCCACTACATTTTTGCAGT...

Protein

Download Protein FASTA

434 aa · LXL04_032736|LXL04_032736|OH1004|PROTEIN

METQRILEFPHKNMDKRPRKRPRLAWDMPAPVPPPPKVLPALYCRQDFINGPVPNFSYSSIYYKGIPHNGSPPWRPDDKEGHYIFAVGENITPRYRILSKMGEGTFGQVLECLDNEKKEPVAIKIVRSISKYREAAMIEIDVLQKLARHDVGGSRCVQIRNWFDYRNHICIVFEKLGPSLYDFLRKNNYRSFPIDLVREFARQLLESVAFMHDLHLIHTDLKPENILLVSSDYVKVPDYKFLSRSGKDGSYFKNLPKTSA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032736`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032736

Location Chr07:28711108-28713999 (-)

Description Similar to AFC1: Serine/threonine-protein kinase AFC1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g53570`	Activator of yeast transcription factor, STE12.	No verified direct reference in this release
`At4g24740`	Serine/threonine-protein kinase AFC2.	No verified direct reference in this release
`At4g32660`	Serine/threonine-protein kinase AFC3.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032736 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006397 mRNA processing Biological Process

GO:0006468 protein phosphorylation Biological Process

GO:0010212 response to ionizing radiation Biological Process

GO:0018108 peptidyl-tyrosine phosphorylation Biological Process

GO:0032526 response to retinoic acid Biological Process

GO:0043484 regulation of RNA splicing Biological Process

GO:0045721 negative regulation of gluconeogenesis Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT3G53570

ath:AT4G24740

ath:AT4G32660

hsa:1196

mmu:12748

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.633

Rank 1 · LXL04_032736 · OH-1004

Cytoplasm0.445

Rank 2 · LXL04_032736 · OH-1004

Cell membrane0.063

Rank 3 · LXL04_032736 · OH-1004

Mitochondrion0.039

Rank 4 · LXL04_032736 · OH-1004

Endoplasmic reticulum0.034

Rank 5 · LXL04_032736 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase95-423 aa

PF07714.24PK_Tyr_Ser-Thr97-332 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032736	`PF00069.32`	Pkinase	95	423	3.2e-49	168.4
LXL04_032736	`PF07714.24`	PK_Tyr_Ser-Thr	97	332	7.9e-22	78.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P51566`	Arabidopsis thaliana	Serine/threonine-protein kinase AFC1	80.698%	Swiss-Prot	strong database homology
`P51567`	Arabidopsis thaliana	Serine/threonine-protein kinase AFC2	70.998%	Swiss-Prot	strong database homology
`P51568`	Arabidopsis thaliana	Serine/threonine-protein kinase AFC3	62.381%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card