LXL04_032633 | RubberDandelionOmics

Gene overview

LXL04_032633

Reference: OH-1004 Chr: Chr07 Coordinates: 26545975-26548900 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1488 bp · LXL04_032633|LXL04_032633|OH1004|cDNA

ATGGAGATCGATAAAGCAATCAGAGAGACTAATGATCAGAAGCTGAAAACCAAGTATAATAACGCCGTCAATGTTATTCAAAGAGCTCTTGCTCTTTACCCTATTGAAGAGGTCGCTTTTAGCTTCAACGGTGGAAAAGATTCAACAGTTCTATTACACCTTCTAAGGGCAGGATATTATTTGCATAAAGTCAATTCCGGTCATTCAAATGGCGATCTATCTACTCACGCATCCACATTCCCAATTAGAACAATATATTT...

CDS

Download CDS FASTA

1488 bp · LXL04_032633|LXL04_032633|OH1004|CDS

ATGGAGATCGATAAAGCAATCAGAGAGACTAATGATCAGAAGCTGAAAACCAAGTATAATAACGCCGTCAATGTTATTCAAAGAGCTCTTGCTCTTTACCCTATTGAAGAGGTCGCTTTTAGCTTCAACGGTGGAAAAGATTCAACAGTTCTATTACACCTTCTAAGGGCAGGATATTATTTGCATAAAGTCAATTCCGGTCATTCAAATGGCGATCTATCTACTCACGCATCCACATTCCCAATTAGAACAATATATTT...

Protein

Download Protein FASTA

495 aa · LXL04_032633|LXL04_032633|OH1004|PROTEIN

MEIDKAIRETNDQKLKTKYNNAVNVIQRALALYPIEEVAFSFNGGKDSTVLLHLLRAGYYLHKVNSGHSNGDLSTHASTFPIRTIYFESPSAFPEINSFTYETASSYGVQLDIIRQDFKSGLEALLKTKPTRAIFLGVRIGDPTAVGQEQFSPSSPGWPPFMRVNPILDWSYRDVWAFLLTCKVPYCSLYDQGYTSIGSVNDTTPNALLCVKDCGKETFKPAYMLSDGRLERAGRVKRLPQKVNNGVKSVFESHQDNIRT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032633`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032633

Location Chr07:26545975-26548900 (+)

Description Similar to Flad1: FAD synthase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g03430`	Catalyzes the adenylation of flavin mononucleotide (FMN) to form flavin adenine dinucleotide (FAD) coenzyme.	A higher plant FAD synthetase is fused to an inactivated FAD pyrophosphatase.2022 · DOI: 10.1016/j.jbc.2022.102626

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032633 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006747 FAD biosynthetic process Biological Process

GO:0006771 riboflavin metabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0097225 sperm midpiece Cellular Component

GO:0097228 sperm principal piece Cellular Component

GO:0097229 sperm end piece Cellular Component

GO:0003919 FMN adenylyltransferase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT5G03430

cre:CHLRE_13g592500v5

mmu:319945

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.728

Rank 1 · LXL04_032633 · OH-1004

Nucleus0.413

Rank 2 · LXL04_032633 · OH-1004

Mitochondrion0.093

Rank 3 · LXL04_032633 · OH-1004

Peroxisome0.029

Rank 4 · LXL04_032633 · OH-1004

Cell membrane0.027

Rank 5 · LXL04_032633 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01507.26PAPS_reduct38-205 aa

PF00994.30MoCF_biosynth263-378 aa

PF24102.2FLAD1_M427-494 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032633	`PF01507.26`	PAPS_reduct	38	205	3.9e-25	89.6
LXL04_032633	`PF00994.30`	MoCF_biosynth	263	378	3.5e-16	59.9
LXL04_032633	`PF24102.2`	FLAD1_M	427	494	8.6e-09	35.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LZE4`	Arabidopsis thaliana	Bifunctional cytosolic FAD synthase/FAD diphosphatase-like	66.667%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card