LXL04_032625 | RubberDandelionOmics

Gene overview

LXL04_032625

Reference: OH-1004 Chr: Chr07 Coordinates: 26406966-26408323 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

753 bp · LXL04_032625|LXL04_032625|OH1004|cDNA

ATGCCAATCCGATCAGTCGCTGTGGGCCGCCATGATGAGTTTAGGCACCCAGATACCATCAAGGCCGGAGTGGCTGAGTTTATCTCCACCCTCATCTTCGTCTTCGCAGGTTCAGGTTCCGGCATGGCTTTCAGCAAGCTAACCGCCGGCGGCGATGCCACCCCTGCTGGCCTTATAGCGGCTTCTATTGCCCATGCTTTCGCCCTGTTTGTGGCGGTTTCCGTCGGTGCTAATATCTCCGGTGGACATGTGAACCCCGC...

CDS

Download CDS FASTA

753 bp · LXL04_032625|LXL04_032625|OH1004|CDS

ATGCCAATCCGATCAGTCGCTGTGGGCCGCCATGATGAGTTTAGGCACCCAGATACCATCAAGGCCGGAGTGGCTGAGTTTATCTCCACCCTCATCTTCGTCTTCGCAGGTTCAGGTTCCGGCATGGCTTTCAGCAAGCTAACCGCCGGCGGCGATGCCACCCCTGCTGGCCTTATAGCGGCTTCTATTGCCCATGCTTTCGCCCTGTTTGTGGCGGTTTCCGTCGGTGCTAATATCTCCGGTGGACATGTGAACCCCGC...

Protein

Download Protein FASTA

250 aa · LXL04_032625|LXL04_032625|OH1004|PROTEIN

MPIRSVAVGRHDEFRHPDTIKAGVAEFISTLIFVFAGSGSGMAFSKLTAGGDATPAGLIAASIAHAFALFVAVSVGANISGGHVNPAVTFGAFVGGNITLIRGIVYVIAQLLGSTVACLLLKFVTNDMAVGAFSLSAGVGVSNALVFEIVMTFGLVYTVYATAVDPKKGDLGTIAPIAIGFIVGANILAGGAFTGASMNPAVSFGPALVSWTWANHWVYWVGPLVGGGIAGLVYEFLFINQTHEHLPTSA

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032625`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032625

Location Chr07:26406966-26408323 (+)

Description Similar to TIP1-1: Aquaporin TIP1-1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g36830`	Water channel required to facilitate the transport of water, diffusion of amino acids and/or peptides from the vacuolar compartment to the cytoplasm.	No verified direct reference in this release
`At3g26520`	Water channel required to facilitate the transport of water across cell membrane.	Characterization of two new channel protein genes in Arabidopsis.1999 · DOI: 10.1016/s1016-8478(23)13513-8 Urea transport by nitrogen-regulated tonoplast intrinsic proteins in Arabidopsis.2003 · DOI: 10.1104/pp.103.027409

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0146100`	Aquaporins facilitate the transport of water and small neutral solutes across cell membranes.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032625 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006833 water transport Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009651 response to salt stress Biological Process

GO:0015840 urea transport Biological Process

GO:0080170 hydrogen peroxide transmembrane transport Biological Process

GO:1902074 response to salt Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0000326 protein storage vacuole Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005774 vacuolar membrane Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

KEGG gene cross-reference

ath:AT2G36830

ath:AT3G26520

dosa:Os03g0146100

mtr:25499345

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.556

Rank 1 · LXL04_032625 · OH-1004

Cell membrane0.237

Rank 2 · LXL04_032625 · OH-1004

Endoplasmic reticulum0.108

Rank 3 · LXL04_032625 · OH-1004

Cytoplasm0.087

Rank 4 · LXL04_032625 · OH-1004

Golgi apparatus0.045

Rank 5 · LXL04_032625 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00230.26MIP14-234 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032625	`PF00230.26`	MIP	14	234	4e-79	266.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P25818`	Arabidopsis thaliana	Aquaporin TIP1-1	79.920%	Swiss-Prot	strong database homology
`Q41963`	Arabidopsis thaliana	Aquaporin TIP1-2	73.307%	Swiss-Prot	strong database homology
`P50156`	Oryza sativa subsp. japonica	Probable aquaporin TIP1-1	79.116%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card