LXL04_032536 | RubberDandelionOmics

Gene overview

LXL04_032536

Reference: OH-1004 Chr: Chr07 Coordinates: 24853984-24855844 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

942 bp · LXL04_032536|LXL04_032536|OH1004|cDNA

ATGGAGGTAGacggcggcggcggtggtgaCGTTTCTGTATCAGTCGCAGTCGTGGCGTGTATCGCTATGACTGTTTTCTACGTTGCCATTCTTTACTCTCCCACATTGATCCTCCGACTCCCGCCTCCTACCTCCTTTAATAGTTACATGACTCGACGGTTCGTTTGCGCTGGTATCTCTACTGTCGTTTCGCTTCTTGTCTGCGCTTTAATCCTCCCTATAAACAGCTGGGAGACATCATACTTGCTAAGTGCTTACGG...

CDS

Download CDS FASTA

942 bp · LXL04_032536|LXL04_032536|OH1004|CDS

ATGGAGGTAGACGGCGGCGGCGGTGGTGACGTTTCTGTATCAGTCGCAGTCGTGGCGTGTATCGCTATGACTGTTTTCTACGTTGCCATTCTTTACTCTCCCACATTGATCCTCCGACTCCCGCCTCCTACCTCCTTTAATAGTTACATGACTCGACGGTTCGTTTGCGCTGGTATCTCTACTGTCGTTTCGCTTCTTGTCTGCGCTTTAATCCTCCCTATAAACAGCTGGGAGACATCATACTTGCTAAGTGCTTACGG...

Protein

Download Protein FASTA

313 aa · LXL04_032536|LXL04_032536|OH1004|PROTEIN

MEVDGGGGGDVSVSVAVVACIAMTVFYVAILYSPTLILRLPPPTSFNSYMTRRFVCAGISTVVSLLVCALILPINSWETSYLLSAYGIRLHHTWEALLLPLTLTSLMYTGSFILKFLSLWTSLTGQQTDLSFHGIKTALQDLINRIQSLICNISSWRLYIVAPFTEELVFRACMIPLLLCGGFKPYTVILLSPVFFSLAHLNHLLEYYMQQNSSLLKACMVVGFQLGYTVIFGSYASFLFIRTGHIAAPLISHMFCNFMG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032536`
TK1151 ID	TkA08G185220
OH-1004 ID	LXL04_032536
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032536

Location Chr07:24853984-24855844 (-)

Description Similar to FACE2: CAAX prenyl protease 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g36305`	Protease involved in the processing of a variety of prenylated proteins containing the C-terminal CAAX motif, where C is a cysteine modified with an isoprenoid lipid, A is an aliphatic amino acid and X is any C-terminal amino acid.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032536 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000165 MAPK cascade Biological Process

GO:0016485 protein processing Biological Process

GO:0018342 protein prenylation Biological Process

GO:0071586 CAAX-box protein processing Biological Process

GO:0080120 CAAX-box protein maturation Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0004175 endopeptidase activity Molecular Function

KEGG gene cross-reference

ath:AT2G36305

cel:CELE_F48F5.5

dme:Dmel_CG4852

hsa:9986

mmu:19671

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.585

Rank 1 · LXL04_032536 · OH-1004

Golgi apparatus0.181

Rank 2 · LXL04_032536 · OH-1004

Nucleus0.123

Rank 3 · LXL04_032536 · OH-1004

Cytoplasm0.081

Rank 4 · LXL04_032536 · OH-1004

Cell membrane0.073

Rank 5 · LXL04_032536 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02517.22Rce1-like156-259 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032536	`PF02517.22`	Rce1-like	156	259	3.1e-16	60.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GW19`	Arabidopsis thaliana	CAAX prenyl protease 2	55.340%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card