LXL04_032489 | RubberDandelionOmics

Gene overview

LXL04_032489

Reference: OH-1004 Chr: Chr07 Coordinates: 24042503-24055747 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3081 bp · LXL04_032489|LXL04_032489|OH1004|cDNA

ATGTCGAGAAAGCCCGGCAAGCATGTCAATGTGTCAATATTCAATAATGACATAATCCACGCAACAACATGGAAAGAACTGTTCATGACGATAACTGCTCATCTTCAATTGTGTTTCATGCTAATGGTACTAGCCTTAACATATGCATACATCCACGTGGAACGGAAGTGGAAAAGAAGTTCTACACCGAAAAACAAGCTTCAAGATGCATTTCATCAACCTGGCAAAATTATTGTTGGAGATGGATTAGCACCATTTTG...

CDS

Download CDS FASTA

3081 bp · LXL04_032489|LXL04_032489|OH1004|CDS

ATGTCGAGAAAGCCCGGCAAGCATGTCAATGTGTCAATATTCAATAATGACATAATCCACGCAACAACATGGAAAGAACTGTTCATGACGATAACTGCTCATCTTCAATTGTGTTTCATGCTAATGGTACTAGCCTTAACATATGCATACATCCACGTGGAACGGAAGTGGAAAAGAAGTTCTACACCGAAAAACAAGCTTCAAGATGCATTTCATCAACCTGGCAAAATTATTGTTGGAGATGGATTAGCACCATTTTG...

Protein

Download Protein FASTA

1026 aa · LXL04_032489|LXL04_032489|OH1004|PROTEIN

MSRKPGKHVNVSIFNNDIIHATTWKELFMTITAHLQLCFMLMVLALTYAYIHVERKWKRSSTPKNKLQDAFHQPGKIIVGDGLAPFWCKKWDMEWGWRCPEGVENKDLESVAIEPPFFLFSIAIEPPSFLFSIAKKLGISRDLPPPSSSVPKRNCSCFHHHFSFFSAHHIRSRGTLRSEESPLSTTPGKLRSEELQYGIVPIFKPTVVKSIDQQTLYALYLRNGHAPKDDNPLALSTADPSDEDSGDVRPVQSSSGSPQV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032489`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032489

Location Chr07:24042503-24055747 (-)

Description Similar to BSPA: Bark storage protein A

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g49950`	Binds preferentially double-stranded telomeric repeats.	Single-Myb-histone proteins from Arabidopsis thaliana: a quantitative study of telomere-binding specificity and kinetics.2009 · DOI: 10.1042/bj20082195

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032489 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006334 nucleosome assembly Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0009116 nucleoside metabolic process Biological Process

GO:0009164 nucleoside catabolic process Biological Process

GO:0019284 L-methionine salvage from S-adenosylmethionine Biological Process

GO:0019509 L-methionine salvage from methylthioadenosine Biological Process

GO:0000781 chromosome, telomeric region Cellular Component

GO:0000785 chromatin Cellular Component

GO:0000786 nucleosome Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

KEGG gene cross-reference

ath:AT1G49950

bha:BH1279

zma:542683

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.247

Rank 1 · LXL04_032489 · OH-1004

Cell membrane0.203

Rank 2 · LXL04_032489 · OH-1004

Cytoplasm0.194

Rank 3 · LXL04_032489 · OH-1004

Nucleus0.156

Rank 4 · LXL04_032489 · OH-1004

Lysosome / Vacuole0.155

Rank 5 · LXL04_032489 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01048.27PNP_UDP_1647-938 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032489	`PF01048.27`	PNP_UDP_1	647	938	5.1e-30	105.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VWK4`	Arabidopsis thaliana	Telomere repeat-binding factor 1	50.679%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card