LXL04_032425 | RubberDandelionOmics

Gene overview

LXL04_032425

Reference: OH-1004 Chr: Chr07 Coordinates: 22535429-22537960 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1983 bp · LXL04_032425|LXL04_032425|OH1004|cDNA

ATGAGCAGAACATCAACAGGAGGTTTAGCTCCAACAAGTGAGCCTAATGCCATAAGACGACCGCAGCAATCCTCCACTGTGAATAGCCCGCAACCACCAACAAATGCTGCAACTACTCCGGCACCGCCGACTCCCCCGGTACCACCACCGCGATTAAGTGCGTCACAGACCTTCATACGACGAGCACCACCGCTCAATCTTCCCTGTGAAGATCTAATTGAAGGAAGAGAAGACTACATCAATACTTGTGTTCCTCTATA...

CDS

Download CDS FASTA

1983 bp · LXL04_032425|LXL04_032425|OH1004|CDS

ATGAGCAGAACATCAACAGGAGGTTTAGCTCCAACAAGTGAGCCTAATGCCATAAGACGACCGCAGCAATCCTCCACTGTGAATAGCCCGCAACCACCAACAAATGCTGCAACTACTCCGGCACCGCCGACTCCCCCGGTACCACCACCGCGATTAAGTGCGTCACAGACCTTCATACGACGAGCACCACCGCTCAATCTTCCCTGTGAAGATCTAATTGAAGGAAGAGAAGACTACATCAATACTTGTGTTCCTCTATA...

Protein

Download Protein FASTA

660 aa · LXL04_032425|LXL04_032425|OH1004|PROTEIN

MSRTSTGGLAPTSEPNAIRRPQQSSTVNSPQPPTNAATTPAPPTPPVPPPRLSASQTFIRRAPPLNLPCEDLIEGREDYINTCVPLYEASINGDWKAANDILTERKELVRFSITDNGETALHIATSAQNTKFVESLVGFMEPEDLELQNKSGNTALCLAAAAGNVEIAKIMVEINRALLIIPGSEGMMPLYMAALFGNHDAVKYLYDNSQKMSDDYWTPQNRSWVVLKCIEADLFDIALKILVDRPELAQSGSLLGVLAR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032425`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032425

Location Chr07:22535429-22537960 (+)

Description Similar to ANK3: Ankyrin-3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g12360`	Involved in salt stress tolerance.	ITN1, a novel gene encoding an ankyrin-repeat protein that affects the ABA-mediated production of reactive oxygen species and is involved in salt-stress tolerance in Arabidopsis thaliana.2008 · DOI: 10.1111/j.1365-313x.2008.03614.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032425 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000281 mitotic cytokinesis Biological Process

GO:0002027 regulation of heart rate Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0006874 intracellular calcium ion homeostasis Biological Process

GO:0006897 endocytosis Biological Process

GO:0007009 plasma membrane organization Biological Process

GO:0007165 signal transduction Biological Process

GO:0007528 neuromuscular junction development Biological Process

GO:0008104 intracellular protein localization Biological Process

GO:0009651 response to salt stress Biological Process

GO:0010628 positive regulation of gene expression Biological Process

GO:0010650 positive regulation of cell communication by electrical coupling Biological Process

KEGG gene cross-reference

ath:AT3G12360

hsa:287

hsa:288

mmu:109676

rno:361833

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.894

Rank 1 · LXL04_032425 · OH-1004

Cytoplasm0.076

Rank 2 · LXL04_032425 · OH-1004

Endoplasmic reticulum0.065

Rank 3 · LXL04_032425 · OH-1004

Nucleus0.032

Rank 4 · LXL04_032425 · OH-1004

Lysosome / Vacuole0.023

Rank 5 · LXL04_032425 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12796.14Ank_2131-210 aa

PF13962.12PGG487-600 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032425	`PF12796.14`	Ank_2	131	210	4.9e-22	79.0
LXL04_032425	`PF13962.12`	PGG	487	600	1.8e-23	83.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C7A2`	Arabidopsis thaliana	Ankyrin repeat-containing protein ITN1	20.348%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card