LXL04_032333 | RubberDandelionOmics

Gene overview

LXL04_032333

Reference: OH-1004 Chr: Chr07 Coordinates: 20736681-20737798 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

798 bp · LXL04_032333|LXL04_032333|OH1004|cDNA

ATGGACAAGTCGTCGCCGGAAAACTTGATCCTCGTCAAGAAAGATCCCGATGGGATAGCTTATGTGACAATCAACCGCCCGAAGTCCTTGAATTCGTTGACGAAGCCAATGATGACTGATATGGCGCGTGCGTTTAAGTCTCTTGCCGCCGACGATTCCGTCGGCGTCATAATACTGTCCGGGTCAGGTCGGTCTTTTTGTTCAGGCGTGGACCTGACAGCGGCGGAGGATGTTTTCAAAGGAGACGTGAAGGATGTGGA...

CDS

Download CDS FASTA

798 bp · LXL04_032333|LXL04_032333|OH1004|CDS

ATGGACAAGTCGTCGCCGGAAAACTTGATCCTCGTCAAGAAAGATCCCGATGGGATAGCTTATGTGACAATCAACCGCCCGAAGTCCTTGAATTCGTTGACGAAGCCAATGATGACTGATATGGCGCGTGCGTTTAAGTCTCTTGCCGCCGACGATTCCGTCGGCGTCATAATACTGTCCGGGTCAGGTCGGTCTTTTTGTTCAGGCGTGGACCTGACAGCGGCGGAGGATGTTTTCAAAGGAGACGTGAAGGATGTGGA...

Protein

Download Protein FASTA

265 aa · LXL04_032333|LXL04_032333|OH1004|PROTEIN

MDKSSPENLILVKKDPDGIAYVTINRPKSLNSLTKPMMTDMARAFKSLAADDSVGVIILSGSGRSFCSGVDLTAAEDVFKGDVKDVEIDPVAQMERCRKPIIGAISGFAITAGFEISLACDILIASKDAKFIDTHARFGIFPSWGLSQKLSRIIGPNNAREVSLTALPLTAEKAEKLGFVNHVVEGSELMKKAREVAEAIMKNNRDLVLRYKAVINDGLKLDLHRALLLEKERAHEYYNGMTKDQFKKMQEFIASRSSKK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032333`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032333

Location Chr07:20736681-20737798 (-)

Description Similar to ECHIA: Probable enoyl-CoA hydratase 1, peroxisomal

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g16210`	Straight-chain enoyl-CoA thioesters from C4 up to at least C16 are processed, although with decreasing catalytic rate.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032333 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006635 fatty acid beta-oxidation Biological Process

GO:0019605 butyrate metabolic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0018812 3-hydroxyacyl-CoA dehydratase activity Molecular Function

GO:0043956 3-hydroxypropionyl-CoA dehydratase activity Molecular Function

GO:0120092 (2E)-butenoyl-CoA hydratase activity Molecular Function

KEGG gene cross-reference

ath:AT4G16210

cac:CA_C2712

ddi:DDB_G0285071

mtu:Rv1070c

mtv:RVBD_1070c

swo:Swol_1936

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Peroxisome0.757

Rank 1 · LXL04_032333 · OH-1004

Cytoplasm0.176

Rank 2 · LXL04_032333 · OH-1004

Mitochondrion0.083

Rank 3 · LXL04_032333 · OH-1004

Endoplasmic reticulum0.068

Rank 4 · LXL04_032333 · OH-1004

Nucleus0.061

Rank 5 · LXL04_032333 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00378.26ECH_117-253 aa

PF16113.11ECH_220-202 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032333	`PF00378.26`	ECH_1	17	253	6.9e-51	173.7
LXL04_032333	`PF16113.11`	ECH_2	20	202	5.3e-26	92.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6NL24`	Arabidopsis thaliana	Probable enoyl-CoA hydratase 1, peroxisomal	75.472%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card