LXL04_032282 | RubberDandelionOmics

Gene overview

LXL04_032282

Reference: OH-1004 Chr: Chr07 Coordinates: 19909002-19912142 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1432 bp · LXL04_032282|LXL04_032282|OH1004|cDNA

TCCCGTTTTATTTATTGGAGGGCCTTCCATTGTTCTTTCTCTCCCACTCTCTATATTGAAACCCTAACTCCCAAATTGTACACAATTTAATCGATTCCAAAAGGGGAGCAGATTAAATTCTCTGTGAATAAGAATGCAACATcagaggctgaagcaacaacaacaacaagcaTTAATGCAGCACGCTCTTCTTCAACAACAATCTCTTTATCATCCAGGCCTCTTAGCTCCCCCACAGATTGAGCCAATTCCTAGTGGAA...

CDS

Download CDS FASTA

1299 bp · LXL04_032282|LXL04_032282|OH1004|CDS

ATGCAACATCAGAGGCTGAAGCAACAACAACAACAAGCATTAATGCAGCACGCTCTTCTTCAACAACAATCTCTTTATCATCCAGGCCTCTTAGCTCCCCCACAGATTGAGCCAATTCCTAGTGGAAATCTGCCTCCTGGGTTTGATCCAAATACATGCCGTAGTGTTTATGTTGGTAACATTCATACACAAGTTACTGAACCACTTCTTCAAGAGGTTTTTGCAAGCACTGGTCCTGTTGAAGGCTGCAAACTCATAAG...

Protein

Download Protein FASTA

432 aa · LXL04_032282|LXL04_032282|OH1004|PROTEIN

MQHQRLKQQQQQALMQHALLQQQSLYHPGLLAPPQIEPIPSGNLPPGFDPNTCRSVYVGNIHTQVTEPLLQEVFASTGPVEGCKLIRKDKSSYGFIHYFDRRSASLAIVSLNGRHLFGQPIKVNWAYASGQREDTSGHYNIFVGDLSPEVTDAMLFACFSAYASCSDARVMWDQKTGRSRGFGFVSFRDQQDAQSAINDLSGKWLGSRQIRCNWATKGAGTSDEKQASDSKSVVELTNGSSEDGKELANSDAPENNPQYT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032282`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032282

Location Chr07:19909002-19912142 (-)

Description Similar to UBP1B: Oligouridylate-binding protein 1B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g17370`	Heterogeneous nuclear ribonucleoprotein (hnRNP)-like protein that acts as a component of the pre-mRNA processing machinery.	No verified direct reference in this release
`At3g14100`	Heterogeneous nuclear ribonucleoprotein (hnRNP)-like protein that acts as a component of the pre-mRNA processing machinery.	No verified direct reference in this release
`At1g54080`	Heterogeneous nuclear ribonucleoprotein (hnRNP)-like protein that acts as a component of the pre-mRNA processing machinery.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0520300`	RNA-binding protein.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032282 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0034063 stress granule assembly Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0010494 cytoplasmic stress granule Cellular Component

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G17370

ath:AT1G54080

ath:AT3G14100

dosa:Os08g0520300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.545

Rank 1 · LXL04_032282 · OH-1004

Cytoplasm0.517

Rank 2 · LXL04_032282 · OH-1004

Cell membrane0.057

Rank 3 · LXL04_032282 · OH-1004

Lysosome / Vacuole0.043

Rank 4 · LXL04_032282 · OH-1004

Golgi apparatus0.030

Rank 5 · LXL04_032282 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00076.29RRM_156-122 aa

PF00076.29RRM_1141-211 aa

PF00076.29RRM_1262-328 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032282	`PF00076.29`	RRM_1	56	122	2.2e-48	162.7
LXL04_032282	`PF00076.29`	RRM_1	141	211	2.2e-48	162.7
LXL04_032282	`PF00076.29`	RRM_1	262	328	2.2e-48	162.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LQI9`	Arabidopsis thaliana	Oligouridylate-binding protein 1B	78.832%	Swiss-Prot	strong database homology
`Q9LJH8`	Arabidopsis thaliana	Oligouridylate-binding protein 1C	76.642%	Swiss-Prot	strong database homology
`Q9SYG4`	Arabidopsis thaliana	Oligouridylate-binding protein 1A	71.838%	Swiss-Prot	strong database homology
`Q6YZW2`	Oryza sativa subsp. japonica	RNA-binding protein 208	62.136%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card