RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_032211
Reference: OH-1004 Chr: Chr07 Coordinates: 18690452-18692795 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1371 bp · LXL04_032211|LXL04_032211|OH1004|cDNA

ATGGAAGAAATGTCTCCTCCTTCCTCGATTACATTCAGCTTAACAAATCCCATTTCCGAAAACTCTCTCGGAAATCATGCGGATTTCACTCGGGTCACACTACTTACAAGAACAGCAAGCTTGTTATCCAAGAACTGCGACATCGCAAATCAAGAAACAGAGATCGATGAAACCATGTCAATCGACGACTCCATTGATGCAAATTCATCAGCTTTACCAATTCCGATTGCGGTCGCAATCGAGGGAAGGGAAAACGATCA...

CDS

Download CDS FASTA

1371 bp · LXL04_032211|LXL04_032211|OH1004|CDS

ATGGAAGAAATGTCTCCTCCTTCCTCGATTACATTCAGCTTAACAAATCCCATTTCCGAAAACTCTCTCGGAAATCATGCGGATTTCACTCGGGTCACACTACTTACAAGAACAGCAAGCTTGTTATCCAAGAACTGCGACATCGCAAATCAAGAAACAGAGATCGATGAAACCATGTCAATCGACGACTCCATTGATGCAAATTCATCAGCTTTACCAATTCCGATTGCGGTCGCAATCGAGGGAAGGGAAAACGATCA...

Protein

Download Protein FASTA

456 aa · LXL04_032211|LXL04_032211|OH1004|PROTEIN

MEEMSPPSSITFSLTNPISENSLGNHADFTRVTLLTRTASLLSKNCDIANQETEIDETMSIDDSIDANSSALPIPIAVAIEGRENDQVVAKVISLGKETIEIANESTLTPSLMALVEKNQSKGIRSVFELEYIPLWGFDSVCGKRPEMEDSVAVVPRFMEIPIKMFVEDHVINSMSSNLTDLTSHFFGVYDGHGGSQVADYCRDRVHLALEEELKLVAQETSKDTLQIQWEKVFTNCFQKVDDEVGGRITHKTPESESEI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_032211
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_032211
LocationChr07:18690452-18692795 (+)
DescriptionSimilar to HAB1: Protein phosphatase 2C 16
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g72770 Key component and repressor of the abscisic acid (ABA) signaling pathway that regulates numerous ABA responses, such as stomatal closure, seed germination and inhibition of vegetative growth.
Gain-of-function and loss-of-function phenotypes of the protein phosphatase 2C HAB1 reveal its role as a negative regulator of abscisic acid signalling.2004 · DOI: 10.1046/j.1365-313x.2003.01966.x
Enhancement of abscisic acid sensitivity and reduction of water consumption in Arabidopsis by combined inactivation of the protein phosphatases type 2C ABI1 and HAB1.2006 · DOI: 10.1104/pp.106.081018
A hypermorphic mutation in the protein phosphatase 2C HAB1 strongly affects ABA signaling in Arabidopsis.2006 · DOI: 10.1016/j.febslet.2006.07.047
At1g17550 Key component and repressor of the abscisic acid (ABA) signaling pathway that regulates numerous ABA responses, such as stomatal closure, seed germination and inhibition of vegetative growth. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os01g0583100 Probable protein phosphatase that may function in abscisic acid (ABA) signaling. No verified direct reference in this release
Os05g0592800 Protein phosphatase that acts as a negative regulator of abscisic acid (ABA) signaling.
ABA Regulates Subcellular Redistribution of OsABI-LIKE2, a Negative Regulator in ABA Signaling, to Control Root Architecture and Drought Resistance in Oryza sativa.2015 · DOI: 10.1093/pcp/pcv154
Os05g0537400 Protein phosphatase involved in abscisic acid (ABA) signaling.
Modulation of ABA Signaling by Altering VxGΦL Motif of PP2Cs in Oryza sativa.2017 · DOI: 10.1016/j.molp.2017.08.003
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_032211 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0009414 response to water deprivation Biological Process
GO:0009738 abscisic acid-activated signaling pathway Biological Process
GO:0009788 negative regulation of abscisic acid-activated signaling pathway Biological Process
GO:0048364 root development Biological Process
GO:1902531 regulation of intracellular signal transduction Biological Process
GO:0005634 nucleus Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0005829 cytosol Cellular Component
GO:0009507 chloroplast Cellular Component
GO:0004722 protein serine/threonine phosphatase activity Molecular Function
GO:0046872 metal ion binding Molecular Function
KEGG gene cross-reference
ath:AT1G17550
ath:AT1G72770
dosa:Os01g0583100
dosa:Os05g0537400
dosa:Os05g0592800
osa:4339797
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.494
Rank 1 · LXL04_032211 · OH-1004
Cytoplasm0.430
Rank 2 · LXL04_032211 · OH-1004
Cell membrane0.149
Rank 3 · LXL04_032211 · OH-1004
Endoplasmic reticulum0.052
Rank 4 · LXL04_032211 · OH-1004
Lysosome / Vacuole0.052
Rank 5 · LXL04_032211 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00481.27PP2C157-439 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_032211PF00481.27PP2C1574399.6e-64216.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9CAJ0Arabidopsis thalianaProtein phosphatase 2C 1650.672%Swiss-Protstrong database homology
Q9LNP9Arabidopsis thalianaProtein phosphatase 2C 750.772%Swiss-Protstrong database homology
Q0JLP9Oryza sativa subsp. japonicaProbable protein phosphatase 2C 664.162%Swiss-Protstrong database homology
Q6L4R7Oryza sativa subsp. japonicaProtein phosphatase 2C 5362.941%Swiss-Protstrong database homology
Q6L5H6Oryza sativa subsp. japonicaProtein phosphatase 2C 5056.305%Swiss-Protstrong database homology

JBrowse

View in Genome Browser