LXL04_032201 | RubberDandelionOmics

Gene overview

LXL04_032201

Reference: OH-1004 Chr: Chr07 Coordinates: 18553590-18556127 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1140 bp · LXL04_032201|LXL04_032201|OH1004|cDNA

ATGGGCAACAACAAGAAGGAAACACTGGACATGTCCGATATCAGCGCCTCCCTACCGGCGGCGGCAGCTGCAGCTCTTAGTGCGGGAGATCGTGCTGGCCTTGTAAACGCTCTGAAGCATAAACTACAAAATCTATCGGGAGAGCACTCGGATGTTCTTGAGAGTTTGACCCCTGCAGTCAGGAAGAGAGTTGAGGTTCTTCAAGGCATTCAGAGTCAACATGATGAGCTAGAGGCGAAGTTTTTTGAAGAGAGAGCAGC...

CDS

Download CDS FASTA

1140 bp · LXL04_032201|LXL04_032201|OH1004|CDS

ATGGGCAACAACAAGAAGGAAACACTGGACATGTCCGATATCAGCGCCTCCCTACCGGCGGCGGCAGCTGCAGCTCTTAGTGCGGGAGATCGTGCTGGCCTTGTAAACGCTCTGAAGCATAAACTACAAAATCTATCGGGAGAGCACTCGGATGTTCTTGAGAGTTTGACCCCTGCAGTCAGGAAGAGAGTTGAGGTTCTTCAAGGCATTCAGAGTCAACATGATGAGCTAGAGGCGAAGTTTTTTGAAGAGAGAGCAGC...

Protein

Download Protein FASTA

379 aa · LXL04_032201|LXL04_032201|OH1004|PROTEIN

MGNNKKETLDMSDISASLPAAAAAALSAGDRAGLVNALKHKLQNLSGEHSDVLESLTPAVRKRVEVLQGIQSQHDELEAKFFEERAALEAKYQKLYEPLYSKRYDIVNGVVEVDGVKTEDAMEQTDDKTTEEKGVPNFWLTAMKTNEILAEEITERDEEALKYLKDIKWCRVDEPKGFKLDFFFNTNPFFKNSLLTKVYHMIDDDEPILEKAIGTDIEWLPGKCLTQKILKKKPKKGSKNTKPITKTENCESFFNFFSPP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032201`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032201

Location Chr07:18553590-18556127 (-)

Description Similar to NAP1;2: Nucleosome assembly protein 1;2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g56950`	May modulate chromatin structure by regulation of nucleosome assembly/disassembly (By similarity).	Molecular and reverse genetic characterization of NUCLEOSOME ASSEMBLY PROTEIN1 (NAP1) genes unravels their function in transcription and nucleotide excision repair in Arabidopsis thaliana.2009 · DOI: 10.1111/j.1365-313x.2009.03844.x A truncated Arabidopsis NUCLEOSOME ASSEMBLY PROTEIN 1, AtNAP1;3T, alters plant growth responses to abscisic acid and salt in the Atnap1;3-2 mutant.2009 · DOI: 10.1093/mp/ssp026
`At2g19480`	May modulate chromatin structure by regulation of nucleosome assembly/disassembly (By similarity).	Molecular and reverse genetic characterization of NUCLEOSOME ASSEMBLY PROTEIN1 (NAP1) genes unravels their function in transcription and nucleotide excision repair in Arabidopsis thaliana.2009 · DOI: 10.1111/j.1365-313x.2009.03844.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0539700`	May modulate chromatin structure by regulation of nucleosome assembly/disassembly.	No verified direct reference in this release
`UniProt: B8AW64`	May modulate chromatin structure by regulation of nucleosome assembly/disassembly.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032201 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0006281 DNA repair Biological Process

GO:0006334 nucleosome assembly Biological Process

GO:0009294 DNA-mediated transformation Biological Process

GO:0016444 somatic cell DNA recombination Biological Process

GO:0000785 chromatin Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009536 plastid Cellular Component

GO:0003682 chromatin binding Molecular Function

KEGG gene cross-reference

ath:AT2G19480

ath:AT5G56950

dosa:Os05g0539700

nta:107760768

osa:4339460

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.704

Rank 1 · LXL04_032201 · OH-1004

Nucleus0.469

Rank 2 · LXL04_032201 · OH-1004

Mitochondrion0.058

Rank 3 · LXL04_032201 · OH-1004

Cell membrane0.051

Rank 4 · LXL04_032201 · OH-1004

Endoplasmic reticulum0.048

Rank 5 · LXL04_032201 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00956.24NAP62-306 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032201	`PF00956.24`	NAP	62	306	2.2e-88	296.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94K07`	Arabidopsis thaliana	Nucleosome assembly protein 1;3	68.241%	Swiss-Prot	strong database homology
`Q9ZUP3`	Arabidopsis thaliana	Nucleosome assembly protein 1;2	74.837%	Swiss-Prot	strong database homology
`Q53WK4`	Oryza sativa subsp. japonica	Nucleosome assembly protein 1;2	70.292%	Swiss-Prot	strong database homology
`B8AW64`	Oryza sativa subsp. indica	Nucleosome assembly protein 1;2	70.292%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card