Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1623 bp · LXL04_031938|LXL04_031938|OH1004|cDNA
ATGCCGGTTGTTGTTGAAAAGTCTCCCACGGAAGAAGCTAAAAACAAAGTGGAAGATGAAGAAgtatcagaagaagaagaagaagaagaggataCATGGTCATCCGATTCTGAAATCGGAGAAGCTTTGGATTATCTGGACGCCAAAGATGATACAGGAGCAGTTGATGGGGCTCTAGTACTCAATGCAAGACGTCCAAATGCTCATGGTGGAATCCACTCACGACCTAATGCCTCTCCTCTTCAACCCCTCTCTAATCG...
1623 bp · LXL04_031938|LXL04_031938|OH1004|CDS
ATGCCGGTTGTTGTTGAAAAGTCTCCCACGGAAGAAGCTAAAAACAAAGTGGAAGATGAAGAAGTATCAGAAGAAGAAGAAGAAGAAGAGGATACATGGTCATCCGATTCTGAAATCGGAGAAGCTTTGGATTATCTGGACGCCAAAGATGATACAGGAGCAGTTGATGGGGCTCTAGTACTCAATGCAAGACGTCCAAATGCTCATGGTGGAATCCACTCACGACCTAATGCCTCTCCTCTTCAACCCCTCTCTAATCG...
Protein
Download Protein FASTA540 aa · LXL04_031938|LXL04_031938|OH1004|PROTEIN
MPVVVEKSPTEEAKNKVEDEEVSEEEEEEEDTWSSDSEIGEALDYLDAKDDTGAVDGALVLNARRPNAHGGIHSRPNASPLQPLSNRNQKFTNHIRASPLEEWEGRWDSGMSNSVTTAIRESVRGMAIGKTKTTEKADRATVEQAIDPRTRMVLFKMLNRGIFHDINGCISTGKEANVYHATKSDGQELAIKVYKTSVLVFKDRDRYVQGDYRFRYGYCKHNPRKMVKTWAEKEMRNLMRLKAAGIRCPTPILLRLHVLV...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_031938 |
|---|---|
| TK1151 ID | TkA08G137450 |
| OH-1004 ID | LXL04_031938 |
| Relationship / confidence | Rbh Sequence Supported / Probable |
| Protein identity (%) | 97.400 |
| Protein coverage (%) | TK1151 99.739 / OH-1004 71.296Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_031938 |
|---|---|
| Location | Chr07:13571556-13573997 (-) |
| Description | Similar to RIOK1: Serine/threonine-protein kinase RIO1 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0000462 maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process GO:0006468 protein phosphorylation Biological Process GO:0007281 germ cell development Biological Process GO:0030490 maturation of SSU-rRNA Biological Process GO:0036093 germ cell proliferation Biological Process GO:0042274 ribosomal small subunit biogenesis Biological Process GO:0043409 negative regulation of MAPK cascade Biological Process GO:0046579 positive regulation of Ras protein signal transduction Biological Process GO:0051321 meiotic cell cycle Biological Process GO:2000234 positive regulation of rRNA processing Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component |
| KEGG gene cross-reference | cel:CELE_M01B12.5 ddi:DDB_G0280431 hsa:83732 mmu:71340 spo:2542923 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF01163.29RIO1177-364 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_031938 | PF01163.29 | RIO1 | 177 | 364 | 3.7e-74 | 249.1 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.