RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_031879
Reference: OH-1004 Chr: Chr07 Coordinates: 12516617-12520040 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2775 bp · LXL04_031879|LXL04_031879|OH1004|cDNA

ATGGCGGGGGCTCTGGTTCAATCCACCAGCTTTCCTTCAACGGTTGCTGGAGACCGCAAGATCCGTTCAAAAAGATCCGGCAATACAAAAGGAGAAATTAAGATGATGTATAGCGTACAAACACCTCCAATGACAGTAAGGTCTTTCTCCGGTCTACGAGGAACCAATGCTTTAGACAACTTGGTAAAAAGAGGTCAAGATTTCCATTCAAAGGTTGCAGCAGCCACCTCTGTCCGCAAAGCCAAGCCTTCTCGAATTGC...

CDS

Download CDS FASTA

2775 bp · LXL04_031879|LXL04_031879|OH1004|CDS

ATGGCGGGGGCTCTGGTTCAATCCACCAGCTTTCCTTCAACGGTTGCTGGAGACCGCAAGATCCGTTCAAAAAGATCCGGCAATACAAAAGGAGAAATTAAGATGATGTATAGCGTACAAACACCTCCAATGACAGTAAGGTCTTTCTCCGGTCTACGAGGAACCAATGCTTTAGACAACTTGGTAAAAAGAGGTCAAGATTTCCATTCAAAGGTTGCAGCAGCCACCTCTGTCCGCAAAGCCAAGCCTTCTCGAATTGC...

Protein

Download Protein FASTA

924 aa · LXL04_031879|LXL04_031879|OH1004|PROTEIN

MAGALVQSTSFPSTVAGDRKIRSKRSGNTKGEIKMMYSVQTPPMTVRSFSGLRGTNALDNLVKRGQDFHSKVAAATSVRKAKPSRIAPKAMFERFTEKAIKVIMLAQEEARRLGHNFVGTEQILLGLIGEGTGIAAKVLKSMGINLKDARVEVEKIIGRGSGFVAVEIPFTPRAKRVLELSLEEARQLGHNYIGSEHLLLGLLREGEGVAARVLENLGADPNNIRTQVIRMVGESAEAVGAGVGGGSSNNKMPTLEEYGT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_031879
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_031879
LocationChr07:12516617-12520040 (+)
DescriptionSimilar to CD4B: ATP-dependent Clp protease ATP-binding subunit ClpA homolog CD4B, chloroplastic
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g50920 Molecular chaperone that hydrolyzes ATP and is associated with the chloroplast protein import apparatus.
Mutations in ClpC2/Hsp100 suppress the requirement for FtsH in thylakoid membrane biogenesis.2004 · DOI: 10.1073/pnas.0402764101
A stromal Hsp100 protein is required for normal chloroplast development and function in Arabidopsis.2004 · DOI: 10.1104/pp.104.052928
In vivo studies on the roles of Tic110, Tic40 and Hsp93 during chloroplast protein import.2005 · DOI: 10.1111/j.1365-313x.2004.02307.x
Clp protease controls chlorophyll b synthesis by regulating the level of chlorophyllide a oxygenase.2007 · DOI: 10.1111/j.1365-313x.2006.02996.x
Further in vivo studies on the role of the molecular chaperone, Hsp93, in plastid protein import.2007 · DOI: 10.1111/j.1365-313x.2007.03060.x
ClpC1, an ATP-dependent Clp protease in plastids, is involved in iron homeostasis in Arabidopsis leaves.2010 · DOI: 10.1093/aob/mcq051
Quantitative analysis of the chloroplast molecular chaperone ClpC/Hsp93 in Arabidopsis reveals new insights into its localization, interaction with the Clp proteolytic core, and functional importance.2014 · DOI: 10.1074/jbc.m113.534552

Rice

Reference gene IDPossible functionPapers / DOI
Os04g0397100 Molecular chaperone that may interact with a ClpP-like protease involved in degradation of denatured proteins in the chloroplast. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_031879 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0009658 chloroplast organization Biological Process
GO:0010380 regulation of chlorophyll biosynthetic process Biological Process
GO:0034605 cellular response to heat Biological Process
GO:0045036 protein targeting to chloroplast Biological Process
GO:0045037 protein import into chloroplast stroma Biological Process
GO:0005739 mitochondrion Cellular Component
GO:0009505 plant-type cell wall Cellular Component
GO:0009507 chloroplast Cellular Component
GO:0009532 plastid stroma Cellular Component
GO:0009535 chloroplast thylakoid membrane Cellular Component
GO:0009536 plastid Cellular Component
GO:0009570 chloroplast stroma Cellular Component
KEGG gene cross-reference
ath:AT5G50920
dosa:Os04g0397100
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.571
Rank 1 · LXL04_031879 · OH-1004
Cytoplasm0.232
Rank 2 · LXL04_031879 · OH-1004
Mitochondrion0.117
Rank 3 · LXL04_031879 · OH-1004
Nucleus0.113
Rank 4 · LXL04_031879 · OH-1004
Cell membrane0.054
Rank 5 · LXL04_031879 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02861.26Clp_N94-216 aa
PF02861.26Clp_N170-240 aa
PF13191.13AAA_16274-320 aa
PF00004.36AAA297-409 aa
PF07728.21AAA_5297-375 aa
PF05621.18TniB339-433 aa
PF17871.8AAA_lid_9435-536 aa
PF02151.26UVR509-544 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_031879PF02861.26Clp_N942161.9e-53180.7
LXL04_031879PF02861.26Clp_N1702401.9e-53180.7
LXL04_031879PF13191.13AAA_162743201.4e-1042.7
LXL04_031879PF00004.36AAA2974091.7e-2487.4
LXL04_031879PF07728.21AAA_52973751.3e-1971.3
LXL04_031879PF05621.18TniB3394335e-0730.1
LXL04_031879PF17871.8AAA_lid_94355364.3e-35120.5
LXL04_031879PF02151.26UVR5095447e-0832.7
LXL04_031879PF00158.33Sigma54_activat6127403.7e-0937.2
LXL04_031879PF07724.21AAA_26348085.6e-72241.9
LXL04_031879PF07728.21AAA_56397601.3e-1971.3
LXL04_031879PF00004.36AAA6407591.7e-2487.4
LXL04_031879PF10431.16ClpB_D2-small8158951.5e-2486.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9FI56Arabidopsis thalianaChaperone protein ClpC1, chloroplastic90.263%Swiss-Protstrong database homology
Q7F9I1Oryza sativa subsp. japonicaChaperone protein ClpC1, chloroplastic87.731%Swiss-Protstrong database homology

JBrowse

View in Genome Browser