LXL04_031784 | RubberDandelionOmics

Gene overview

LXL04_031784

Reference: OH-1004 Chr: Chr07 Coordinates: 11307655-11315677 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3339 bp · LXL04_031784|LXL04_031784|OH1004|cDNA

ATGGGGGAAGTGGCGACCGACGATTATGAAGTTGTGATAATCGGAGCAGGGATTTGCGGATTAGCGACGGCCCTCGCTCTTCACAAGAAGGGAATTAAAAGCATAGTATTGGAGAGATCGGAAGCTCTGAGAAACATAACCGGTGCAGCAATCGGAATCCGCCAAAATGGTTGGCGAGCTTTGGATCAGCTTGGCGTCGGCGACATCCTCCGCCGCACTGCTATCAATATGCAGAGGAAAGGCGAACTTCGATCCTTGAA...

CDS

Download CDS FASTA

3339 bp · LXL04_031784|LXL04_031784|OH1004|CDS

ATGGGGGAAGTGGCGACCGACGATTATGAAGTTGTGATAATCGGAGCAGGGATTTGCGGATTAGCGACGGCCCTCGCTCTTCACAAGAAGGGAATTAAAAGCATAGTATTGGAGAGATCGGAAGCTCTGAGAAACATAACCGGTGCAGCAATCGGAATCCGCCAAAATGGTTGGCGAGCTTTGGATCAGCTTGGCGTCGGCGACATCCTCCGCCGCACTGCTATCAATATGCAGAGGAAAGGCGAACTTCGATCCTTGAA...

Protein

Download Protein FASTA

1112 aa · LXL04_031784|LXL04_031784|OH1004|PROTEIN

MGEVATDDYEVVIIGAGICGLATALALHKKGIKSIVLERSEALRNITGAAIGIRQNGWRALDQLGVGDILRRTAINMQRKGELRSLKRKELIDTLYAALPPATVKFGCELESIKLNPNTKKPVLQFIDGSSMMPKVVIGCEGGKSIVANFLNVKPTKMFPLCGVRGLSNYPNGHTFNQEFARFRKDNNLVGRIPIDTNLVYWFCARPYIPIDERIKEDPEAIRHSTVALLSDYPEELKEMIEIADANSLSFTNLRYRAPW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_031784`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_031784

Location Chr07:11307655-11315677 (-)

Description Similar to MO1: Monooxygenase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g15760`	Monooxygenase 1.	No verified direct reference in this release
`At4g38540`	Monooxygenase 2.	No verified direct reference in this release
`At5g05320`	Monooxygenase 3.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031784 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002239 response to oomycetes Biological Process

GO:0009620 response to fungus Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0004497 monooxygenase activity Molecular Function

GO:0071949 FAD binding Molecular Function

KEGG gene cross-reference

ath:AT4G15760

ath:AT4G38540

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.498

Rank 1 · LXL04_031784 · OH-1004

Nucleus0.167

Rank 2 · LXL04_031784 · OH-1004

Peroxisome0.120

Rank 3 · LXL04_031784 · OH-1004

Mitochondrion0.101

Rank 4 · LXL04_031784 · OH-1004

Cell membrane0.097

Rank 5 · LXL04_031784 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01494.26FAD_binding_38-87 aa

PF01266.31DAO11-63 aa

PF00890.31FAD_binding_211-50 aa

PF13738.13Pyr_redox_312-42 aa

PF13450.13NAD_binding_813-41 aa

PF01494.26FAD_binding_399-326 aa

PF01494.26FAD_binding_3456-688 aa

PF01494.26FAD_binding_3709-781 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_031784	`PF01494.26`	FAD_binding_3	8	87	4.6e-67	227.4
LXL04_031784	`PF01266.31`	DAO	11	63	1e-16	62.2
LXL04_031784	`PF00890.31`	FAD_binding_2	11	50	1.6e-10	41.5
LXL04_031784	`PF13738.13`	Pyr_redox_3	12	42	1.3e-10	41.7
LXL04_031784	`PF13450.13`	NAD_binding_8	13	41	1.1e-11	45.6
LXL04_031784	`PF01494.26`	FAD_binding_3	99	326	4.6e-67	227.4
LXL04_031784	`PF01494.26`	FAD_binding_3	456	688	4.6e-67	227.4
LXL04_031784	`PF01494.26`	FAD_binding_3	709	781	4.6e-67	227.4
LXL04_031784	`PF01266.31`	DAO	710	765	1e-16	62.2
LXL04_031784	`PF00890.31`	FAD_binding_2	710	753	1.6e-10	41.5
LXL04_031784	`PF13738.13`	Pyr_redox_3	711	739	1.3e-10	41.7
LXL04_031784	`PF13450.13`	NAD_binding_8	712	741	1.1e-11	45.6
LXL04_031784	`PF01494.26`	FAD_binding_3	798	1029	4.6e-67	227.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O81815`	Arabidopsis thaliana	Monooxygenase 1	45.028%	Swiss-Prot	weak database homology
`O81816`	Arabidopsis thaliana	Monooxygenase 2	34.574%	Swiss-Prot	weak database homology
`Q9FLC2`	Arabidopsis thaliana	Monooxygenase 3	32.258%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card