LXL04_031731 | RubberDandelionOmics

Gene overview

LXL04_031731

Reference: OH-1004 Chr: Chr07 Coordinates: 10355757-10359185 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2072 bp · LXL04_031731|LXL04_031731|OH1004|cDNA

ATCTTTAAATTGTGTACTTTGAATAACCTATGCTAACTTCCTATGTTATTTCAGGTTTCACACATACTGCCTTCACATTAGGTTATGAGGCAGGCCTAAATAAAAGCACAATAGATGGAAACTTAGTTCCACCTGGCGCCCTTGTTACTTTCGTGCAGAAAGGAATTCAGTATCTTGAGCTAGAAGCCAACCTCACATGTACTGATTCGGACATCGATGAAGATTTCTCCTTCATACAACCAATCGATTTGATCACAAAG...

CDS

Download CDS FASTA

2043 bp · LXL04_031731|LXL04_031731|OH1004|CDS

ATGCTAACTTCCTATGTTATTTCAGGTTTCACACATACTGCCTTCACATTAGGTTATGAGGCAGGCCTAAATAAAAGCACAATAGATGGAAACTTAGTTCCACCTGGCGCCCTTGTTACTTTCGTGCAGAAAGGAATTCAGTATCTTGAGCTAGAAGCCAACCTCACATGTACTGATTCGGACATCGATGAAGATTTCTCCTTCATACAACCAATCGATTTGATCACAAAGGATGTTTATGAGCTACAAAAAATGATAAA...

Protein

Download Protein FASTA

680 aa · LXL04_031731|LXL04_031731|OH1004|PROTEIN

MLTSYVISGFTHTAFTLGYEAGLNKSTIDGNLVPPGALVTFVQKGIQYLELEANLTCTDSDIDEDFSFIQPIDLITKDVYELQKMIKEKKESVQKSKNREKNKEHEQEVSVREKEKEREKEHEQQEHVRERERERERHVKEKEKEQQERQHREREKKIEQEQHNIREKEKEKEKEKEKQQRERDREVEREKVERERDKGKHKEKKNEDIEEKIRVQVQQPEENMIEEGVEPMEIDTNSTAIPSVIPNSDVTILEGHTSEV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_031731`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_031731

Location Chr07:10355757-10359185 (+)

Description Similar to HOS15: WD40 repeat-containing protein HOS15

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g67320`	Acts as a repressor of cold stress-regulated gene expression.	Involvement of Arabidopsis HOS15 in histone deacetylation and cold tolerance.2008 · DOI: 10.1073/pnas.0801029105

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031731 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0002021 response to dietary excess Biological Process

GO:0006325 chromatin organization Biological Process

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0009409 response to cold Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0016042 lipid catabolic process Biological Process

GO:0035264 multicellular organism growth Biological Process

GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process

GO:0043627 response to estrogen Biological Process

KEGG gene cross-reference

ath:AT5G67320

mmu:21372

mmu:81004

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.646

Rank 1 · LXL04_031731 · OH-1004

Cytoplasm0.321

Rank 2 · LXL04_031731 · OH-1004

Cell membrane0.057

Rank 3 · LXL04_031731 · OH-1004

Golgi apparatus0.038

Rank 4 · LXL04_031731 · OH-1004

Lysosome / Vacuole0.037

Rank 5 · LXL04_031731 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24817.2WD40_WDHD1_1st244-304 aa

PF25173.2Beta-prop_WDR3_1st247-296 aa

PF25175.2Beta-prop_WDR5248-300 aa

PF24807.2WD40_CDC20-Fz248-288 aa

PF25174.2Beta-prop_THOC3249-302 aa

PF25047.1Beta-prop_TEP1_2nd249-345 aa

PF00400.39WD40250-284 aa

PF24814.2WD40_Prp19251-303 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_031731	`PF24817.2`	WD40_WDHD1_1st	244	304	2.7e-48	165.4
LXL04_031731	`PF25173.2`	Beta-prop_WDR3_1st	247	296	5e-58	196.5
LXL04_031731	`PF25175.2`	Beta-prop_WDR5	248	300	1.6e-72	245.0
LXL04_031731	`PF24807.2`	WD40_CDC20-Fz	248	288	7.3e-48	164.1
LXL04_031731	`PF25174.2`	Beta-prop_THOC3	249	302	4.2e-62	210.3
LXL04_031731	`PF25047.1`	Beta-prop_TEP1_2nd	249	345	7.1e-24	85.1
LXL04_031731	`PF00400.39`	WD40	250	284	3.7e-63	208.0
LXL04_031731	`PF24814.2`	WD40_Prp19	251	303	4e-51	174.5
LXL04_031731	`PF23409.2`	Beta-prop_EML	251	390	1.2e-18	68.4
LXL04_031731	`PF23381.2`	Beta-prop_IFT122_1st	252	298	2.2e-64	218.2
LXL04_031731	`PF24105.2`	Beta-prop_CAF1B_HIR1	252	358	3.3e-37	129.1
LXL04_031731	`PF25460.2`	Beta-prop_Aladin	283	392	3.4e-27	96.2
LXL04_031731	`PF23414.2`	Beta-prop_EML_2	311	408	1.4e-30	107.3
LXL04_031731	`PF29037.1`	DSE1_N	312	389	8.2e-19	68.6
LXL04_031731	`PF25175.2`	Beta-prop_WDR5	313	409	1.6e-72	245.0
LXL04_031731	`PF25173.2`	Beta-prop_WDR3_1st	313	422	5e-58	196.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FN19`	Arabidopsis thaliana	WD40 repeat-containing protein HOS15	61.589%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card