LXL04_031702 | RubberDandelionOmics

Gene overview

LXL04_031702

Reference: OH-1004 Chr: Chr07 Coordinates: 9845672-9846127 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

456 bp · LXL04_031702|LXL04_031702|OH1004|cDNA

ATGGAGGTAGCCGGCGGCTGTTCTTCCAAGAGAAAGGAGATTCACTCAATTGAAGCCAACAAACCCTACAGAGGAATCAGGATGAGGAAGTGGGGGAAGTGGGTCGCCGAGATTCGAGAACCCAACAAACGTTCCCGTATCTGGCTTGGTTCTTATTCCTCTCCAGTCGCCGCCGCCCGTGCCTACGACACCGCCGTTTTTTACCTCCGCGGCCCATCGGCACGTCTTAACTTTCCTGAGTCAATCGGAGAAGACGGTGA...

CDS

Download CDS FASTA

456 bp · LXL04_031702|LXL04_031702|OH1004|CDS

ATGGAGGTAGCCGGCGGCTGTTCTTCCAAGAGAAAGGAGATTCACTCAATTGAAGCCAACAAACCCTACAGAGGAATCAGGATGAGGAAGTGGGGGAAGTGGGTCGCCGAGATTCGAGAACCCAACAAACGTTCCCGTATCTGGCTTGGTTCTTATTCCTCTCCAGTCGCCGCCGCCCGTGCCTACGACACCGCCGTTTTTTACCTCCGCGGCCCATCGGCACGTCTTAACTTTCCTGAGTCAATCGGAGAAGACGGTGA...

Protein

Download Protein FASTA

151 aa · LXL04_031702|LXL04_031702|OH1004|PROTEIN

MEVAGGCSSKRKEIHSIEANKPYRGIRMRKWGKWVAEIREPNKRSRIWLGSYSSPVAAARAYDTAVFYLRGPSARLNFPESIGEDGDLHDLSSASIRKKATEVGAKVDALQNQNGGINHQHHSPSTRGISGRVCLNTDLNEYPSPESSDEN

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_031702`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_031702

Location Chr07:9845672-9846127 (-)

Description Similar to ERF010: Ethylene-responsive transcription factor ERF010

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g67190`	Probably acts as a transcriptional activator.	No verified direct reference in this release
`At3g50260`	Probably acts as a transcriptional activator.	No verified direct reference in this release
`At2g23340`	Probably acts as a transcriptional activator.	No verified direct reference in this release
`At4g36900`	Probably acts as a transcriptional activator.	No verified direct reference in this release
`At4g06746`	Probably acts as a transcriptional activator.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031702 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0009409 response to cold Biological Process

GO:0009617 response to bacterium Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0043068 positive regulation of programmed cell death Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0071502 cellular response to temperature stimulus Biological Process

GO:1900057 positive regulation of leaf senescence Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003677 DNA binding Molecular Function

KEGG gene cross-reference

ath:AT2G23340

ath:AT3G50260

ath:AT4G06746

ath:AT4G36900

ath:AT5G67190

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.951

Rank 1 · LXL04_031702 · OH-1004

Cytoplasm0.092

Rank 2 · LXL04_031702 · OH-1004

Cell membrane0.028

Rank 3 · LXL04_031702 · OH-1004

Endoplasmic reticulum0.019

Rank 4 · LXL04_031702 · OH-1004

Plastid0.019

Rank 5 · LXL04_031702 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00847.27AP223-71 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_031702	`PF00847.27`	AP2	23	71	9.6e-12	45.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FH94`	Arabidopsis thaliana	Ethylene-responsive transcription factor ERF010	55.901%	Swiss-Prot	strong database homology
`Q9SNE1`	Arabidopsis thaliana	Ethylene-responsive transcription factor ERF011	54.730%	Swiss-Prot	strong database homology
`O22174`	Arabidopsis thaliana	Ethylene-responsive transcription factor ERF008	60.284%	Swiss-Prot	strong database homology
`Q9SW63`	Arabidopsis thaliana	Ethylene-responsive transcription factor RAP2-10	50.000%	Swiss-Prot	strong database homology
`Q8W3M3`	Arabidopsis thaliana	Ethylene-responsive transcription factor RAP2-9	59.286%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card