LXL04_031690 | RubberDandelionOmics

Gene overview

LXL04_031690

Reference: OH-1004 Chr: Chr07 Coordinates: 9557728-9561949 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1479 bp · LXL04_031690|LXL04_031690|OH1004|cDNA

ATGGCAGGTGCTGAAGAATTCTGTGAAAATTACTTGGTGCTTGATGCCAGCGAAGCAAGTCTCTACGATATCGCCTGTATTTTGATATGTTCGACTGCTTTCTTGAACACAAAAAAGTTTTACAACGAACGATCTGAAGATGTGGGAAAGTCAACCCAGAGCTTCCGGCGACGGTGGCTCATCTTCGCCTCCGTGCTCATACAGAAGCTTCTGCTATGGGCGAAAAAGCCCATGGCTGTTATAGGGTCTTTGATCGAGCT...

CDS

Download CDS FASTA

1479 bp · LXL04_031690|LXL04_031690|OH1004|CDS

ATGGCAGGTGCTGAAGAATTCTGTGAAAATTACTTGGTGCTTGATGCCAGCGAAGCAAGTCTCTACGATATCGCCTGTATTTTGATATGTTCGACTGCTTTCTTGAACACAAAAAAGTTTTACAACGAACGATCTGAAGATGTGGGAAAGTCAACCCAGAGCTTCCGGCGACGGTGGCTCATCTTCGCCTCCGTGCTCATACAGAAGCTTCTGCTATGGGCGAAAAAGCCCATGGCTGTTATAGGGTCTTTGATCGAGCT...

Protein

Download Protein FASTA

492 aa · LXL04_031690|LXL04_031690|OH1004|PROTEIN

MAGAEEFCENYLVLDASEASLYDIACILICSTAFLNTKKFYNERSEDVGKSTQSFRRRWLIFASVLIQKLLLWAKKPMAVIGSLIELWLNIVSSNGGVFGFLINVITGKVVNPVESPENYNSIIGLLDKRLKLDQSIKKGDRKYEPMLAMMASKLAYENEALVQDAVSQHLKMDFIGFYKFWNDYQKKFTTYAILFRDTSNPNLIVLAFRGTGAYDATEWMADVDISWYELKDPKNSRTIGKIHGGFMKALGLQQIKGWP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_031690`
TK1151 ID	TkA08G122290
OH-1004 ID	LXL04_031690
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_031690

Location Chr07:9557728-9561949 (-)

Description Similar to OBL1: Triacylglycerol lipase OBL1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g14360`	Acid lipase that can hydrolyze a range of triacylglycerols without a clear preference for acyl-chains.	Characterization of the enzymatic activity and physiological function of the lipid droplet-associated triacylglycerol lipase AtOBL1.2018 · DOI: 10.1111/nph.14902

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031690 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006629 lipid metabolic process Biological Process

GO:0016042 lipid catabolic process Biological Process

GO:0016998 cell wall macromolecule catabolic process Biological Process

GO:0030245 cellulose catabolic process Biological Process

GO:0045490 pectin catabolic process Biological Process

GO:0045493 xylan catabolic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005811 lipid droplet Cellular Component

GO:0016020 membrane Cellular Component

GO:0090406 pollen tube Cellular Component

GO:0004806 triacylglycerol lipase activity Molecular Function

GO:0030248 cellulose binding Molecular Function

KEGG gene cross-reference

ang:An09g00120

ath:AT3G14360

nta:107788962

rcu:8284735

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.328

Rank 1 · LXL04_031690 · OH-1004

Cytoplasm0.174

Rank 2 · LXL04_031690 · OH-1004

Golgi apparatus0.159

Rank 3 · LXL04_031690 · OH-1004

Lysosome / Vacuole0.158

Rank 4 · LXL04_031690 · OH-1004

Cell membrane0.123

Rank 5 · LXL04_031690 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01764.32Lipase_3206-374 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_031690	`PF01764.32`	Lipase_3	206	374	4.6e-33	114.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JFU8`	Arabidopsis thaliana	Triacylglycerol lipase OBL1	40.716%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card