LXL04_031617 | RubberDandelionOmics

Gene overview

LXL04_031617

Reference: OH-1004 Chr: Chr07 Coordinates: 8511006-8516293 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2649 bp · LXL04_031617|LXL04_031617|OH1004|cDNA

ATGGCGAAATCGAGCGCCGATGATCTGGAGCTCCGGCGAGCTTGCGAAGCTGCAATTGAGGGCACCGACCAGAAGGTTGGTCTGTCGATCCGCGTCGCGAAAAGCCGTGGTGTTTGGGGTAAGGCAGGCAAAATAGGCAAAGGTCAGATGGCTAAGCCTAGGGTTCTTGCAATCTCCACAAAAGAAAAAGCTCAAGAGATTAAGGCTTTTCTCCATGTCTTAAAGTATTCAAATGGAGGAGTCCTTGAGCCTGCAAAATT...

CDS

Download CDS FASTA

2649 bp · LXL04_031617|LXL04_031617|OH1004|CDS

ATGGCGAAATCGAGCGCCGATGATCTGGAGCTCCGGCGAGCTTGCGAAGCTGCAATTGAGGGCACCGACCAGAAGGTTGGTCTGTCGATCCGCGTCGCGAAAAGCCGTGGTGTTTGGGGTAAGGCAGGCAAAATAGGCAAAGGTCAGATGGCTAAGCCTAGGGTTCTTGCAATCTCCACAAAAGAAAAAGCTCAAGAGATTAAGGCTTTTCTCCATGTCTTAAAGTATTCAAATGGAGGAGTCCTTGAGCCTGCAAAATT...

Protein

Download Protein FASTA

882 aa · LXL04_031617|LXL04_031617|OH1004|PROTEIN

MAKSSADDLELRRACEAAIEGTDQKVGLSIRVAKSRGVWGKAGKIGKGQMAKPRVLAISTKEKAQEIKAFLHVLKYSNGGVLEPAKLYKLKHLSKVEVLTNDPSGCTFMLGFDNLRSQSVAPPQWTMRNIDDRNRLLLYILNMCKDVLGRLPKVVGIDVVEMALWAKENTPVAPKKKNIEDGPTTDVVAESDMKVTVEKELVSQAEEEDMEALLGVYVMGIGEAEAFSERLKRELHALEAANVHAILESEPLVDEVLQGL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_031617`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_031617

Location Chr07:8511006-8516293 (+)

Description Similar to SEC3A: Exocyst complex component SEC3A

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g47550`	Component of the exocyst complex involved in the docking of exocytic vesicles with fusion sites on the plasma membrane during regulated or polarized secretion.	The Arabidopsis exocyst subunit SEC3A is essential for embryo development and accumulates in transient puncta at the plasma membrane.2013 · DOI: 10.1111/nph.12236
`At1g47560`	Component of the exocyst complex involved in the docking of exocytic vesicles with fusion sites on the plasma membrane during regulated or polarized secretion.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031617 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000281 mitotic cytokinesis Biological Process

GO:0006887 exocytosis Biological Process

GO:0006893 Golgi to plasma membrane transport Biological Process

GO:0006904 vesicle docking involved in exocytosis Biological Process

GO:0015031 protein transport Biological Process

GO:0016241 regulation of macroautophagy Biological Process

GO:0048868 pollen tube development Biological Process

GO:0051607 defense response to virus Biological Process

GO:0060321 acceptance of pollen Biological Process

GO:0090148 membrane fission Biological Process

GO:0090522 vesicle tethering involved in exocytosis Biological Process

GO:0000145 exocyst Cellular Component

KEGG gene cross-reference

ath:AT1G47550

ath:AT1G47560

dme:Dmel_CG3885

hsa:55763

mmu:69940

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.605

Rank 1 · LXL04_031617 · OH-1004

Golgi apparatus0.262

Rank 2 · LXL04_031617 · OH-1004

Cell membrane0.184

Rank 3 · LXL04_031617 · OH-1004

Nucleus0.123

Rank 4 · LXL04_031617 · OH-1004

Lysosome / Vacuole0.094

Rank 5 · LXL04_031617 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF15277.13Sec3-PIP2_bind50-145 aa

PF09763.16Sec3_CC224-345 aa

PF04129.19Vps52_CC257-393 aa

PF20654.4Sec3_C-term578-865 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_031617	`PF15277.13`	Sec3-PIP2_bind	50	145	3.3e-14	53.4
LXL04_031617	`PF09763.16`	Sec3_CC	224	345	1.9e-27	96.4
LXL04_031617	`PF04129.19`	Vps52_CC	257	393	2e-08	34.9
LXL04_031617	`PF20654.4`	Sec3_C-term	578	865	3.4e-29	102.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SX85`	Arabidopsis thaliana	Exocyst complex component SEC3A	82.623%	Swiss-Prot	strong database homology
`Q9SX86`	Arabidopsis thaliana	Exocyst complex component SEC3B	80.157%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card