LXL04_031536 | RubberDandelionOmics

Gene overview

LXL04_031536

Reference: OH-1004 Chr: Chr07 Coordinates: 7244181-7246733 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1283 bp · LXL04_031536|LXL04_031536|OH1004|cDNA

GGAACCCTTCTACACATTTTTGAAACAAGCAAATATTCAAAAAGAGTcgagaaaaaaaaaaaccccTTCCCAAATTCCTCTCTTTCGCTTTTGCACCTGGTTTTCTTCAAGCGTATGCACTAATGGATGCAATACGTAAACAAGCTTCGAAGCTCAGAGAACAGGTGGCTAGACAGCAACAGGCTGTTCTCAAACAATTTGCTGGTGGACTTGGAGGTTCTGAAGATATTGTAGCCAATGAAGTAGAACTACAACAGCAA...

CDS

Download CDS FASTA

1161 bp · LXL04_031536|LXL04_031536|OH1004|CDS

ATGGATGCAATACGTAAACAAGCTTCGAAGCTCAGAGAACAGGTGGCTAGACAGCAACAGGCTGTTCTCAAACAATTTGCTGGTGGACTTGGAGGTTCTGAAGATATTGTAGCCAATGAAGTAGAACTACAACAGCAACAAAAGCTTGAAAAGCTTTACATATCAACCAGATCTGCCAAGCTATTTGCCATATTATATCTTACAATCCCCGATTTTCTTAAATCTTACCAGCACTTTCAACGCGATATTGTCCGTGGTGT...

Protein

Download Protein FASTA

386 aa · LXL04_031536|LXL04_031536|OH1004|PROTEIN

MDAIRKQASKLREQVARQQQAVLKQFAGGLGGSEDIVANEVELQQQQKLEKLYISTRSAKLFAILYLTIPDFLKSYQHFQRDIVRGVEGFIVTGSKQVEIGTKLSEDSRKYGAENTCTSGNALSKAAMSYSNARMDIERERENLLKTLGTQVAEPLRAMVVGAPLEDARRHAQRYDRVRQEAEAQVIEVARRQAKVRENSGNVDNLSKFEAAQARLQELKSNMNVLGKEAVATMSAVEAQQQRLTLQRLISMVEAEKHHH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_031536`
TK1151 ID	TkA08G112150
OH-1004 ID	LXL04_031536
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	95.300
Protein coverage (%)	TK1151 90.441 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_031536

Location Chr07:7244181-7246733 (+)

Description Similar to SH3P2: SH3 domain-containing protein 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g34660`	May regulate autophagosome formation or maturation.	A BAR-domain protein SH3P2, which binds to phosphatidylinositol 3-phosphate and ATG8, regulates autophagosome formation in Arabidopsis.2013 · DOI: 10.1105/tpc.113.118307 SH3 Domain-Containing Protein 2 Plays a Crucial Role at the Step of Membrane Tubulation during Cell Plate Formation.2017 · DOI: 10.1105/tpc.17.00108
`At4g18060`	May be involved in the recruitment of DRP2A to the accessory protein complex and in the negative regulation of its GTPase activity.	No verified direct reference in this release
`At1g31440`	Lipid binding protein bound strongly to phosphatidic acid, phosphatidylinositol-4-phosphate and phosphatidylinositol-4,5- bisphosphate.	Role of SH3 domain-containing proteins in clathrin-mediated vesicle trafficking in Arabidopsis.2001 · DOI: 10.1105/tpc.010279

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031536 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006897 endocytosis Biological Process

GO:0007165 signal transduction Biological Process

GO:0009920 cell plate formation involved in plant-type cell wall biogenesis Biological Process

GO:0061024 membrane organization Biological Process

GO:0072319 vesicle uncoating Biological Process

GO:0072583 clathrin-dependent endocytosis Biological Process

GO:1903527 positive regulation of membrane tubulation Biological Process

GO:0000421 autophagosome membrane Cellular Component

GO:0002102 podosome Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005768 endosome Cellular Component

KEGG gene cross-reference

ath:AT1G31440

ath:AT4G18060

ath:AT4G34660

gga:395202

hsa:6455

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.670

Rank 1 · LXL04_031536 · OH-1004

Cell membrane0.233

Rank 2 · LXL04_031536 · OH-1004

Nucleus0.173

Rank 3 · LXL04_031536 · OH-1004

Golgi apparatus0.136

Rank 4 · LXL04_031536 · OH-1004

Lysosome / Vacuole0.082

Rank 5 · LXL04_031536 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14604.13SH3_9325-372 aa

PF07653.24SH3_2325-372 aa

PF00018.35SH3_1326-368 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_031536	`PF14604.13`	SH3_9	325	372	1.5e-10	41.5
LXL04_031536	`PF07653.24`	SH3_2	325	372	2.5e-09	37.4
LXL04_031536	`PF00018.35`	SH3_1	326	368	8.2e-09	35.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VWF1`	Arabidopsis thaliana	SH3 domain-containing protein 2	63.117%	Swiss-Prot	strong database homology
`Q8L7W0`	Arabidopsis thaliana	SH3 domain-containing protein 3	48.446%	Swiss-Prot	moderate database homology
`Q9C865`	Arabidopsis thaliana	SH3 domain-containing protein 1	39.868%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card