LXL04_031497 | RubberDandelionOmics

Gene overview

LXL04_031497

Reference: OH-1004 Chr: Chr07 Coordinates: 6892030-6893500 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

738 bp · LXL04_031497|LXL04_031497|OH1004|cDNA

ATGAAGCTTCCCACAATGAATCAGACAGTCTCTGAATTGAAGGATTTTGTTAAAAAGCTCAACTCATTGCCAGAAATGAGTaGGCACATAAATCTTGCTCAACATTTATCCACGCTTACTTCAAAGCCTTGGTTTCTTGGACGACTTGACATGGAACATACTATTGTGGAGGCCGAGAGCTATGACATATGCTTGGAGTACATTGAAGAGATGATTCATAAACAGGAGCCTCTTGTTAGTGTTCTAAGACTCGTTATCTT...

CDS

Download CDS FASTA

738 bp · LXL04_031497|LXL04_031497|OH1004|CDS

ATGAAGCTTCCCACAATGAATCAGACAGTCTCTGAATTGAAGGATTTTGTTAAAAAGCTCAACTCATTGCCAGAAATGAGTAGGCACATAAATCTTGCTCAACATTTATCCACGCTTACTTCAAAGCCTTGGTTTCTTGGACGACTTGACATGGAACATACTATTGTGGAGGCCGAGAGCTATGACATATGCTTGGAGTACATTGAAGAGATGATTCATAAACAGGAGCCTCTTGTTAGTGTTCTAAGACTCGTTATCTT...

Protein

Download Protein FASTA

245 aa · LXL04_031497|LXL04_031497|OH1004|PROTEIN

MKLPTMNQTVSELKDFVKKLNSLPEMSRHINLAQHLSTLTSKPWFLGRLDMEHTIVEAESYDICLEYIEEMIHKQEPLVSVLRLVILLSVTNAGLPKRNFDHIRREILHSYGFEHIATLNNLEKASLIKKQEGQSNWLTIKRALQLVVEDTDTTNPKDISYVFSGYTPLSIRLIQHAIRSGWRPLEEISKLFPGTHTESKRVGIFIFINNLKSFITYLIVTYMDKLQDGRRSLVLVVFVGEPLCK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_031497`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_031497

Location Chr07:6892030-6893500 (+)

Description Similar to VPS33: Vacuolar protein-sorting-associated protein 33 homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g54860`	Involved in regulating membrane fusion at the tonoplast and the prevacuolar compartment.	The AtC-VPS protein complex is localized to the tonoplast and the prevacuolar compartment in arabidopsis.2003 · DOI: 10.1091/mbc.e02-08-0509

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031497 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006622 protein targeting to lysosome Biological Process

GO:0006727 ommochrome biosynthetic process Biological Process

GO:0006886 intracellular protein transport Biological Process

GO:0006897 endocytosis Biological Process

GO:0007032 endosome organization Biological Process

GO:0007033 vacuole organization Biological Process

GO:0007220 Notch receptor processing Biological Process

GO:0008057 eye pigment granule organization Biological Process

GO:0008333 endosome to lysosome transport Biological Process

GO:0008340 determination of adult lifespan Biological Process

GO:0009267 cellular response to starvation Biological Process

GO:0016192 vesicle-mediated transport Biological Process

KEGG gene cross-reference

ath:AT3G54860

dme:Dmel_CG12230

hsa:65082

mmu:77573

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.380

Rank 1 · LXL04_031497 · OH-1004

Nucleus0.346

Rank 2 · LXL04_031497 · OH-1004

Mitochondrion0.236

Rank 3 · LXL04_031497 · OH-1004

Cell membrane0.064

Rank 4 · LXL04_031497 · OH-1004

Endoplasmic reticulum0.057

Rank 5 · LXL04_031497 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00995.29Sec17-240 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_031497	`PF00995.29`	Sec1	7	240	2.1e-36	127.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94KJ7`	Arabidopsis thaliana	Vacuolar protein-sorting-associated protein 33 homolog	68.240%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card