LXL04_031494 | RubberDandelionOmics

Gene overview

LXL04_031494

Reference: OH-1004 Chr: Chr07 Coordinates: 6808344-6809930 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1023 bp · LXL04_031494|LXL04_031494|OH1004|cDNA

ATGGGGTGCTCTTTCTCGGGACTCAACGCCTTATACGATTCAACTACTGGTGATGTTTGGATCAACGAAAATCGGTTCAAAGTTATCCGGCAACTAGGCGAAGGTGGATTTGCCTTTGTGTATCTAGTTAAGGAAGTTGTCACTGACGCTTCCGATGGTGGTGTCTCTAAGAAATTCAAAGATCCCTCTTTCGTCTCTGATGACGGAACTTATGCTATGAAGAAAGTCCTGATTCAGAATAACGAGCAGTTGCAGTTCGT...

CDS

Download CDS FASTA

1023 bp · LXL04_031494|LXL04_031494|OH1004|CDS

ATGGGGTGCTCTTTCTCGGGACTCAACGCCTTATACGATTCAACTACTGGTGATGTTTGGATCAACGAAAATCGGTTCAAAGTTATCCGGCAACTAGGCGAAGGTGGATTTGCCTTTGTGTATCTAGTTAAGGAAGTTGTCACTGACGCTTCCGATGGTGGTGTCTCTAAGAAATTCAAAGATCCCTCTTTCGTCTCTGATGACGGAACTTATGCTATGAAGAAAGTCCTGATTCAGAATAACGAGCAGTTGCAGTTCGT...

Protein

Download Protein FASTA

340 aa · LXL04_031494|LXL04_031494|OH1004|PROTEIN

MGCSFSGLNALYDSTTGDVWINENRFKVIRQLGEGGFAFVYLVKEVVTDASDGGVSKKFKDPSFVSDDGTYAMKKVLIQNNEQLQFVKEEIRISSLFNHPNLLPLLDHAIIPVKGTPEQSWTHEAYLLFPVHLDGTLLDNAKVMKLKKEFFSTSDVLQIFRQLCAGLEHMHSLETPYAHNDVKPGNVLLTHRKGKPPLAILMDFGSARPARKQIRSRSEALQLQEWAAEHVSAPFRSPELWDCPSQADIDERTDVWSLGC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_031494`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_031494`
Location	Chr07:6808344-6809930 (-)
Description	Similar to STK16: Serine/threonine-protein kinase 16
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_031494` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006468 protein phosphorylation Biological Process GO:0006624 vacuolar protein processing Biological Process GO:0023052 signaling Biological Process GO:0032889 regulation of vacuole fusion, non-autophagic Biological Process GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process GO:0046777 protein autophosphorylation Biological Process GO:0071560 cellular response to transforming growth factor beta stimulus Biological Process GO:0005654 nucleoplasm Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005773 vacuole Cellular Component GO:0005783 endoplasmic reticulum Cellular Component GO:0005794 Golgi apparatus Cellular Component
KEGG gene cross-reference	ddi:DDB_G0280111 hsa:8576 mmu:20872 rno:286927 spo:2543440 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.670

Rank 1 · LXL04_031494 · OH-1004

Nucleus0.369

Rank 2 · LXL04_031494 · OH-1004

Cell membrane0.083

Rank 3 · LXL04_031494 · OH-1004

Lysosome / Vacuole0.073

Rank 4 · LXL04_031494 · OH-1004

Golgi apparatus0.072

Rank 5 · LXL04_031494 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07714.24PK_Tyr_Ser-Thr29-328 aa

PF00069.32Pkinase67-330 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_031494	`PF07714.24`	PK_Tyr_Ser-Thr	29	328	4.2e-14	53.2
LXL04_031494	`PF00069.32`	Pkinase	67	330	4.3e-31	109.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card