LXL04_031409 | RubberDandelionOmics

Gene overview

LXL04_031409

Reference: OH-1004 Chr: Chr07 Coordinates: 5498532-5502221 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

918 bp · LXL04_031409|LXL04_031409|OH1004|cDNA

ATGATCCTTCAATCACGAATTTCACCTCCTCTTAAACAAATCCCACTAATTGGGTCTCAGTCTCACCGCTCTCTCTTCGTTTCCTCCTTTATTTCCCACAAACTTCCCATCAAAATTAACTTCACTCGCCAACATTTCTCCCTTCAGACATGTGGAAGAGAATTGAAAGCTTTTCAGACACTTATCTCAGCAAAACTTGACGAACCACCAAGTGACAAGGATGCAAGGAACTCAAAAAGGGATTTGATTAGCATGGCAGT...

CDS

Download CDS FASTA

918 bp · LXL04_031409|LXL04_031409|OH1004|CDS

ATGATCCTTCAATCACGAATTTCACCTCCTCTTAAACAAATCCCACTAATTGGGTCTCAGTCTCACCGCTCTCTCTTCGTTTCCTCCTTTATTTCCCACAAACTTCCCATCAAAATTAACTTCACTCGCCAACATTTCTCCCTTCAGACATGTGGAAGAGAATTGAAAGCTTTTCAGACACTTATCTCAGCAAAACTTGACGAACCACCAAGTGACAAGGATGCAAGGAACTCAAAAAGGGATTTGATTAGCATGGCAGT...

Protein

Download Protein FASTA

305 aa · LXL04_031409|LXL04_031409|OH1004|PROTEIN

MILQSRISPPLKQIPLIGSQSHRSLFVSSFISHKLPIKINFTRQHFSLQTCGRELKAFQTLISAKLDEPPSDKDARNSKRDLISMAVISTGSLSLLTWSNPAAAAASEYQKLNPVYEVGELFELGIQLSYLLLLLGLLGVGTFFVIRQVLVRRELDLSAKELQEQVRSGDASATELFELGAVMLRRKFYPAAIKYLKQAIDKWDGDDQDLAQVYNALGVSYVRDEKTDKGISQLETAVKIQPGYVTAWNNLGDAYEKKKE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_031409`
TK1151 ID	TkA08G105340
OH-1004 ID	LXL04_031409
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 72.459 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_031409

Location Chr07:5498532-5502221 (+)

Description Similar to PYG7: Tetratricopeptide repeat domain-containing protein PYG7, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g22700`	Nuclear genome-encoded factor required for the accumulation of photosystem I (PSI).	The evolutionarily conserved tetratrico peptide repeat protein pale yellow green7 is required for photosystem I accumulation in Arabidopsis and copurifies with the complex.2006 · DOI: 10.1104/pp.106.078147 PSA3, a Protein on the Stromal Face of the Thylakoid Membrane, Promotes Photosystem I Accumulation in Cooperation with the Assembly Factor PYG7.2017 · DOI: 10.1104/pp.17.00524

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031409 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0048564 photosystem I assembly Biological Process

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

KEGG gene cross-reference

ath:AT1G22700

zma:100279224

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.983

Rank 1 · LXL04_031409 · OH-1004

Mitochondrion0.022

Rank 2 · LXL04_031409 · OH-1004

Nucleus0.018

Rank 3 · LXL04_031409 · OH-1004

Cytoplasm0.012

Rank 4 · LXL04_031409 · OH-1004

Cell membrane0.009

Rank 5 · LXL04_031409 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29407.1CFAP70_TPR_C164-278 aa

PF13424.13TPR_12178-241 aa

PF13432.13TPR_16216-276 aa

PF14559.13TPR_19224-278 aa

PF13414.13TPR_11231-258 aa

PF07719.24TPR_2246-278 aa

PF13181.13TPR_8246-278 aa

PF00515.35TPR_1247-278 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_031409	`PF29407.1`	CFAP70_TPR_C	164	278	3.8e-07	30.6
LXL04_031409	`PF13424.13`	TPR_12	178	241	6.2e-13	49.5
LXL04_031409	`PF13432.13`	TPR_16	216	276	4.1e-10	40.6
LXL04_031409	`PF14559.13`	TPR_19	224	278	1.5e-06	29.1
LXL04_031409	`PF13414.13`	TPR_11	231	258	5.6e-10	39.5
LXL04_031409	`PF07719.24`	TPR_2	246	278	2e-17	62.5
LXL04_031409	`PF13181.13`	TPR_8	246	278	2.7e-12	46.5
LXL04_031409	`PF00515.35`	TPR_1	247	278	6e-14	51.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`B9DHG0`	Arabidopsis thaliana	Tetratricopeptide repeat domain-containing protein PYG7, chloroplastic	64.856%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card