LXL04_031207 | RubberDandelionOmics

Gene overview

LXL04_031207

Reference: OH-1004 Chr: Chr07 Coordinates: 2457996-2460267 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2124 bp · LXL04_031207|LXL04_031207|OH1004|cDNA

ATGGAAAAGAATGAAGGGTACAAGTCTACTGAGCAAAAAGAATCAGAAAATCCAGATCCATCATTAAGGATTTCCACATCTCCAAAATCACCAAGATCCCCAAAAACTCGTCATGGCAACAAAGGGAGCCCAGTCAAAGGAATCAGCCCACGAAAAAACGACCGCCATTCCCATTCCGGAACCGACGGCCGTCCCAAAAAAGGTGGTTGTGGCGGGAAGGGAACATGGGGCGGATTACTTGATACGGATGATAATCACTT...

CDS

Download CDS FASTA

2124 bp · LXL04_031207|LXL04_031207|OH1004|CDS

ATGGAAAAGAATGAAGGGTACAAGTCTACTGAGCAAAAAGAATCAGAAAATCCAGATCCATCATTAAGGATTTCCACATCTCCAAAATCACCAAGATCCCCAAAAACTCGTCATGGCAACAAAGGGAGCCCAGTCAAAGGAATCAGCCCACGAAAAAACGACCGCCATTCCCATTCCGGAACCGACGGCCGTCCCAAAAAAGGTGGTTGTGGCGGGAAGGGAACATGGGGCGGATTACTTGATACGGATGATAATCACTT...

Protein

Download Protein FASTA

707 aa · LXL04_031207|LXL04_031207|OH1004|PROTEIN

MEKNEGYKSTEQKESENPDPSLRISTSPKSPRSPKTRHGNKGSPVKGISPRKNDRHSHSGTDGRPKKGGCGGKGTWGGLLDTDDNHFVDNNDPNYTSSEENDKTAVKKVCPRFEEYKKKAAVIVEEYFATDDVVSTANELKDLEMASYSYYFVKKLISMAMDRHDKEKEMAAVLLSSLYADVIDPRQVYKGFRKLVESADDLIVDIPDTVDVLALFVARAVVDDILPPAFLNKESDALPVGSKGIDVIKRADKGYLSAPL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_031207`
TK1151 ID	TkA08G094180
OH-1004 ID	LXL04_031207
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 54.455 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_031207

Location Chr07:2457996-2460267 (-)

Description Similar to MRF2: MA3 DOMAIN-CONTAINING TRANSLATION REGULATORY FACTOR 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g22730`	Involved in target of rapamycin (TOR)-regulated translation control, especially under energy-deficient conditions.	No verified direct reference in this release
`At5g63190`	Involved in target of rapamycin (TOR)-regulated translation control, especially under energy-deficient conditions.	MRF Family Genes Are Involved in Translation Control, Especially under Energy-Deficient Conditions, and Their Expression and Functions Are Modulated by the TOR Signaling Pathway.2017 · DOI: 10.1105/tpc.17.00563
`At4g24800`	Involved in target of rapamycin (TOR)-regulated translation control, especially under energy-deficient conditions.	EIN2 regulates salt stress response and interacts with a MA3 domain-containing protein ECIP1 in Arabidopsis.2011 · DOI: 10.1111/j.1365-3040.2011.02363.x
`At3g48390`	Involved in target of rapamycin (TOR)-regulated translation control, especially under energy-deficient conditions.	MRF Family Genes Are Involved in Translation Control, Especially under Energy-Deficient Conditions, and Their Expression and Functions Are Modulated by the TOR Signaling Pathway.2017 · DOI: 10.1105/tpc.17.00563

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031207 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006417 regulation of translation Biological Process

GO:0009646 response to absence of light Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009723 response to ethylene Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0090549 response to carbon starvation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G22730

ath:AT4G24800

ath:AT5G63190

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.616

Rank 1 · LXL04_031207 · OH-1004

Nucleus0.341

Rank 2 · LXL04_031207 · OH-1004

Cell membrane0.126

Rank 3 · LXL04_031207 · OH-1004

Golgi apparatus0.076

Rank 4 · LXL04_031207 · OH-1004

Lysosome / Vacuole0.062

Rank 5 · LXL04_031207 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02847.24MA3117-227 aa

PF02847.24MA3281-390 aa

PF02847.24MA3415-525 aa

PF02847.24MA3584-692 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_031207	`PF02847.24`	MA3	117	227	1.6e-104	344.5
LXL04_031207	`PF02847.24`	MA3	281	390	1.6e-104	344.5
LXL04_031207	`PF02847.24`	MA3	415	525	1.6e-104	344.5
LXL04_031207	`PF02847.24`	MA3	584	692	1.6e-104	344.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O80548`	Arabidopsis thaliana	MA3 DOMAIN-CONTAINING TRANSLATION REGULATORY FACTOR 2	64.984%	Swiss-Prot	strong database homology
`Q94BR1`	Arabidopsis thaliana	MA3 DOMAIN-CONTAINING TRANSLATION REGULATORY FACTOR 1	54.204%	Swiss-Prot	strong database homology
`Q8W4Q4`	Arabidopsis thaliana	MA3 DOMAIN-CONTAINING TRANSLATION REGULATORY FACTOR 3	51.920%	Swiss-Prot	strong database homology
`Q9STL9`	Arabidopsis thaliana	MA3 DOMAIN-CONTAINING TRANSLATION REGULATORY FACTOR 4	52.787%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card