LXL04_031182 | RubberDandelionOmics

Gene overview

LXL04_031182

Reference: OH-1004 Chr: Chr07 Coordinates: 1921391-1935099 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

7830 bp · LXL04_031182|LXL04_031182|OH1004|cDNA

ATGATTAAACTTTCACCAGCAATAAAAGAAAGATTCAGCATATACGGATCGGGTCGCGATTCGGATCATCAACTGAACCGCCTATCTGCCTGCCCACCCACCCTCTACATCACGCCCTACCCCGACCATCGCCCTATAAAACCCTCGCTCAGGTCTCTCCTCAAATACACATCAAATTCACGGACAAGTTTCCCTTGTGAATTCTCTCTCTCCCCTTCCCTCACTCCTACTTTTGCTCTACTGGATTTGAATCAGCAAAT...

CDS

Download CDS FASTA

7830 bp · LXL04_031182|LXL04_031182|OH1004|CDS

ATGATTAAACTTTCACCAGCAATAAAAGAAAGATTCAGCATATACGGATCGGGTCGCGATTCGGATCATCAACTGAACCGCCTATCTGCCTGCCCACCCACCCTCTACATCACGCCCTACCCCGACCATCGCCCTATAAAACCCTCGCTCAGGTCTCTCCTCAAATACACATCAAATTCACGGACAAGTTTCCCTTGTGAATTCTCTCTCTCCCCTTCCCTCACTCCTACTTTTGCTCTACTGGATTTGAATCAGCAAAT...

Protein

Download Protein FASTA

2609 aa · LXL04_031182|LXL04_031182|OH1004|PROTEIN

MIKLSPAIKERFSIYGSGRDSDHQLNRLSACPPTLYITPYPDHRPIKPSLRSLLKYTSNSRTSFPCEFSLSPSLTPTFALLDLNQQIRTQTINHRAFRTGNRAEEDEESDGVFSFQPQRAVPSTTHTSDLFTSSNSPRRIINNNAFSHASSVSGFQPFIRPKVEQPSEVDEDKKRAIDNITHVEVNKDKKRAIEITPIEVDEDTKRAIEITPVEVDEDKKTGIEVIPVEVNEDKNSAINTKLDIEKEEGEWSDADDNPKA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_031182`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_031182

Location Chr07:1921391-1935099 (+)

Description Similar to SPBC29A10.10c: Uncharacterized ATP-dependent helicase C29A10.10c (Schizosaccharomyces pombe (strain 972 / ATCC 24843)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g15570`	Probable helicase that may regulate RNA molecules involved in nucleolar organization and pollen tube guidance.	Attractive and repulsive interactions between female and male gametophytes in Arabidopsis pollen tube guidance.2000 · DOI: 10.1242/dev.127.20.4511 MAA3 (MAGATAMA3) helicase gene is required for female gametophyte development and pollen tube guidance in Arabidopsis thaliana.2008 · DOI: 10.1093/pcp/pcn130

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031182 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006283 transcription-coupled nucleotide-excision repair Biological Process

GO:0006353 DNA-templated transcription termination Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0006364 rRNA processing Biological Process

GO:0006369 termination of RNA polymerase II transcription Biological Process

GO:0006386 termination of RNA polymerase III transcription Biological Process

GO:0006397 mRNA processing Biological Process

GO:0006399 tRNA metabolic process Biological Process

GO:0006974 DNA damage response Biological Process

GO:0008033 tRNA processing Biological Process

GO:0016180 snRNA processing Biological Process

GO:0031123 RNA 3'-end processing Biological Process

KEGG gene cross-reference

sce:YLR430W

spo:2540523

spo:2541556

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.635

Rank 1 · LXL04_031182 · OH-1004

Cytoplasm0.267

Rank 2 · LXL04_031182 · OH-1004

Mitochondrion0.080

Rank 3 · LXL04_031182 · OH-1004

Plastid0.045

Rank 4 · LXL04_031182 · OH-1004

Cell membrane0.042

Rank 5 · LXL04_031182 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF20073.6DUF6469519-635 aa

PF13086.13AAA_11766-1119 aa

PF13245.13AAA_19797-1114 aa

PF13087.13AAA_121126-1322 aa

PF20073.6DUF64691736-1824 aa

PF13086.13AAA_111983-2336 aa

PF13245.13AAA_192015-2331 aa

PF13087.13AAA_122343-2539 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_031182	`PF20073.6`	DUF6469	519	635	3.3e-12	47.1
LXL04_031182	`PF13086.13`	AAA_11	766	1119	3.7e-119	397.9
LXL04_031182	`PF13245.13`	AAA_19	797	1114	6.4e-12	46.5
LXL04_031182	`PF13087.13`	AAA_12	1126	1322	1.4e-126	420.3
LXL04_031182	`PF20073.6`	DUF6469	1736	1824	3.3e-12	47.1
LXL04_031182	`PF13086.13`	AAA_11	1983	2336	3.7e-119	397.9
LXL04_031182	`PF13245.13`	AAA_19	2015	2331	6.4e-12	46.5
LXL04_031182	`PF13087.13`	AAA_12	2343	2539	1.4e-126	420.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`B6SFA4`	Arabidopsis thaliana	Probable helicase MAGATAMA 3	43.082%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card