LXL04_031130 | RubberDandelionOmics

Gene overview

LXL04_031130

Reference: OH-1004 Chr: Chr07 Coordinates: 970276-972735 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1428 bp · LXL04_031130|LXL04_031130|OH1004|cDNA

ATGAGGAAGAAGAGAAAAGGCAGTGACCTAATATGCACTGACAATAAAAAGAAAATCGTGGAATCAACCGGTGATTCAGAGTCTCTGATATCAAATCTCAAGTCTCATTACTCTCTAGAAGATTACGTTAGATTGAAAAAAAGGTGCTGTAAGGAAGATGTGATCTGCGGTGGTGGTGATTCCAGTGGATCGTGTAAGAACAGGCTTGCTGGTATTGCTGCAACTGCTCCCCCTTGTGCAACCTCGTCACTGGTTTTATC...

CDS

Download CDS FASTA

1428 bp · LXL04_031130|LXL04_031130|OH1004|CDS

ATGAGGAAGAAGAGAAAAGGCAGTGACCTAATATGCACTGACAATAAAAAGAAAATCGTGGAATCAACCGGTGATTCAGAGTCTCTGATATCAAATCTCAAGTCTCATTACTCTCTAGAAGATTACGTTAGATTGAAAAAAAGGTGCTGTAAGGAAGATGTGATCTGCGGTGGTGGTGATTCCAGTGGATCGTGTAAGAACAGGCTTGCTGGTATTGCTGCAACTGCTCCCCCTTGTGCAACCTCGTCACTGGTTTTATC...

Protein

Download Protein FASTA

475 aa · LXL04_031130|LXL04_031130|OH1004|PROTEIN

MRKKRKGSDLICTDNKKKIVESTGDSESLISNLKSHYSLEDYVRLKKRCCKEDVICGGGDSSGSCKNRLAGIAATAPPCATSSLVLSGRGIKRKIGCIDVATQMGRKNKIAEDYVKGATIGKGKFGSVWLCRCRVSGVEFACKTLVKGEETVHREVEIMQHLSGHPGVVTLKAVYEDSESFHLVMELCSGGRLIDQMTKEGRYSEQRAANIFKELMMVIKYCHDMGVVHRDVKPENILLTASGKIKLADFGLAVRITNGQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_031130`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_031130

Location Chr07:970276-972735 (-)

Description Similar to PEPKR2: Serine/threonine-protein kinase PEPKR2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g12680`	Serine/threonine-protein kinase PEPKR2.	No verified direct reference in this release
`At1g76040`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release
`At1g50700`	Ca(2+)-dependent protein kinase.	THI1, a Thiamine Thiazole Synthase, Interacts with Ca2+-Dependent Protein Kinase CPK33 and Modulates the S-Type Anion Channels and Stomatal Closure in Arabidopsis.2016 · DOI: 10.1104/pp.15.01649

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0788500`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031130 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0035556 intracellular signal transduction Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0004683 calcium/calmodulin-dependent protein kinase activity Molecular Function

GO:0005509 calcium ion binding Molecular Function

GO:0005516 calmodulin binding Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0009931 calcium-dependent protein serine/threonine kinase activity Molecular Function

GO:0106310 protein serine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G12680

ath:AT1G50700

ath:AT1G76040

dosa:Os03g0788500

gmx:547825

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.818

Rank 1 · LXL04_031130 · OH-1004

Cytoplasm0.222

Rank 2 · LXL04_031130 · OH-1004

Cell membrane0.053

Rank 3 · LXL04_031130 · OH-1004

Endoplasmic reticulum0.027

Rank 4 · LXL04_031130 · OH-1004

Mitochondrion0.018

Rank 5 · LXL04_031130 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase114-362 aa

PF07714.24PK_Tyr_Ser-Thr118-356 aa

PF03109.23ABC1174-258 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_031130	`PF00069.32`	Pkinase	114	362	2.2e-69	234.5
LXL04_031130	`PF07714.24`	PK_Tyr_Ser-Thr	118	356	1.1e-32	114.1
LXL04_031130	`PF03109.23`	ABC1	174	258	9.8e-07	28.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8W490`	Arabidopsis thaliana	Serine/threonine-protein kinase PEPKR2	64.389%	Swiss-Prot	strong database homology
`Q8RWL2`	Arabidopsis thaliana	Calcium-dependent protein kinase 29	46.245%	Swiss-Prot	moderate database homology
`Q9C6P3`	Arabidopsis thaliana	Calcium-dependent protein kinase 33	44.402%	Swiss-Prot	moderate database homology
`Q6F3A6`	Oryza sativa subsp. japonica	Calcium-dependent protein kinase 10	40.127%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card