LXL04_031053 | RubberDandelionOmics

Gene overview

LXL04_031053

Reference: OH-1004 Chr: Chr06 Coordinates: 127269068-127275122 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1782 bp · LXL04_031053|LXL04_031053|OH1004|cDNA

ATGACCACCGATCTCAAGTCCAAATTTCTCCAAGTTTATGATACTCTCAAATCGGAGTTAATCAACGATCCTGCCTTCGAGTTCGATGACGATTCTCGGCAATGGGTTGAAAAGATGCTTGACTACAATGTACCTGGAGGAAAGCTGAACCGTGGACTCTCTGTTGTTGACAGCTACCAGTTGCTTAAAGGCGGAGAACTAACAGAAGAGGAGATTTTTCTTTCATCTGCCCTTGGTTGGTGTGTTGAATGGCTCCAAGC...

CDS

Download CDS FASTA

1782 bp · LXL04_031053|LXL04_031053|OH1004|CDS

ATGACCACCGATCTCAAGTCCAAATTTCTCCAAGTTTATGATACTCTCAAATCGGAGTTAATCAACGATCCTGCCTTCGAGTTCGATGACGATTCTCGGCAATGGGTTGAAAAGATGCTTGACTACAATGTACCTGGAGGAAAGCTGAACCGTGGACTCTCTGTTGTTGACAGCTACCAGTTGCTTAAAGGCGGAGAACTAACAGAAGAGGAGATTTTTCTTTCATCTGCCCTTGGTTGGTGTGTTGAATGGCTCCAAGC...

Protein

Download Protein FASTA

593 aa · LXL04_031053|LXL04_031053|OH1004|PROTEIN

MTTDLKSKFLQVYDTLKSELINDPAFEFDDDSRQWVEKMLDYNVPGGKLNRGLSVVDSYQLLKGGELTEEEIFLSSALGWCVEWLQAYFLVLDDIMDESHTRRGQPCWFRLPKVGMIAANDGIILRNHVPRILKKHFRGKPYYIDLVDLFNEVEFQTASGQMIDLITTLVGEKDLSKYSLSIHRRIVQYKTAYYSFYLPVACALLMFGEDLEKHVEVKDVLVEMGTYFQVQDDYLDCFGAPEVIGKIGTDIEDFKCSWLV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_031053`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_031053`
Location	Chr06:127269068-127275122 (+)
Description	Similar to FPS1: Farnesyl pyrophosphate synthase
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_031053` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006695 cholesterol biosynthetic process Biological Process GO:0009739 response to gibberellin Biological Process GO:0033384 geranyl diphosphate biosynthetic process Biological Process GO:0045337 farnesyl diphosphate biosynthetic process Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0004161 dimethylallyltranstransferase activity Molecular Function GO:0004337 (2E,6E)-farnesyl diphosphate synthase activity Molecular Function GO:0046872 metal ion binding Molecular Function
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.591

Rank 1 · LXL04_031053 · OH-1004

Nucleus0.206

Rank 2 · LXL04_031053 · OH-1004

Endoplasmic reticulum0.147

Rank 3 · LXL04_031053 · OH-1004

Cell membrane0.129

Rank 4 · LXL04_031053 · OH-1004

Mitochondrion0.115

Rank 5 · LXL04_031053 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00348.23polyprenyl_synt34-296 aa

PF13499.13EF-hand_7430-478 aa

PF13499.13EF-hand_7489-554 aa

PF00036.39EF-hand_1535-559 aa

PF13202.13EF-hand_5535-559 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_031053	`PF00348.23`	polyprenyl_synt	34	296	8e-78	261.8
LXL04_031053	`PF13499.13`	EF-hand_7	430	478	3.1e-15	57.0
LXL04_031053	`PF13499.13`	EF-hand_7	489	554	3.1e-15	57.0
LXL04_031053	`PF00036.39`	EF-hand_1	535	559	2.2e-17	61.9
LXL04_031053	`PF13202.13`	EF-hand_5	535	559	1.8e-14	53.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card