LXL04_030961 | RubberDandelionOmics

Gene overview

LXL04_030961

Reference: OH-1004 Chr: Chr06 Coordinates: 125707627-125711056 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2436 bp · LXL04_030961|LXL04_030961|OH1004|cDNA

ATGATGAGGAAGATCGATCAGAAGCAACGAtacggtggcggtggtggtggtaggATTGCAAGTAACAATGGATTCATACCGTCTTCCTTTCGCTCGCTTTCAAGCTACTTGAGGATTGTGTCCTCTGGTGCATCAACCGTCGCATCCACTGTTCGTTCTGCAGCTTCAGCTGCATCCACCATTGTCGACCGTGATAATGACGCAGTTCCCGATCAGGTGCTCTGGGCTGGATTTGACAAACTCGAATGTGAGGGAGATAC...

CDS

Download CDS FASTA

2436 bp · LXL04_030961|LXL04_030961|OH1004|CDS

ATGATGAGGAAGATCGATCAGAAGCAACGATACGGTGGCGGTGGTGGTGGTAGGATTGCAAGTAACAATGGATTCATACCGTCTTCCTTTCGCTCGCTTTCAAGCTACTTGAGGATTGTGTCCTCTGGTGCATCAACCGTCGCATCCACTGTTCGTTCTGCAGCTTCAGCTGCATCCACCATTGTCGACCGTGATAATGACGCAGTTCCCGATCAGGTGCTCTGGGCTGGATTTGACAAACTCGAATGTGAGGGAGATAC...

Protein

Download Protein FASTA

811 aa · LXL04_030961|LXL04_030961|OH1004|PROTEIN

MMRKIDQKQRYGGGGGGRIASNNGFIPSSFRSLSSYLRIVSSGASTVASTVRSAASAASTIVDRDNDAVPDQVLWAGFDKLECEGDTSRRVLLLGFQFGFQVWDVEDANNVRNIVSRYDGAVFSMQLLPKPIVPKHSQLEYANSRPIMVICADGSFPANGNIKNGQEQVNGGSVPTVVWFYSLKSQSYIKELKFRSVVYSVKCSSRIVAVLQAAQIHCFDVATLQREYTILTNSISTTSSRFENIGLGPLAVGPRWIAYS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030961`
TK1151 ID	TkA07G441600
OH-1004 ID	LXL04_030961
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_030961

Location Chr06:125707627-125711056 (+)

Description Similar to ATG18F: Autophagy-related protein 18f

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g54730`	The PI(3,5)P2 regulatory complex regulates both the synthesis and turnover of phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2).	No verified direct reference in this release
`At1g03380`	The PI(3,5)P2 regulatory complex regulates both the synthesis and turnover of phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2).	No verified direct reference in this release
`At1g54710`	The PI(3,5)P2 regulatory complex regulates both the synthesis and turnover of phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030961 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006914 autophagy Biological Process

GO:0007267 cell-cell signaling Biological Process

GO:0010595 positive regulation of endothelial cell migration Biological Process

GO:0015031 protein transport Biological Process

GO:0032956 regulation of actin cytoskeleton organization Biological Process

GO:0042594 response to starvation Biological Process

GO:0043085 positive regulation of catalytic activity Biological Process

GO:0043627 response to estrogen Biological Process

GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process

GO:0071391 cellular response to estrogen stimulus Biological Process

GO:0000407 phagophore assembly site Cellular Component

KEGG gene cross-reference

ath:AT1G03380

ath:AT1G54710

ath:AT5G54730

hsa:54828

mmu:192197

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.426

Rank 1 · LXL04_030961 · OH-1004

Nucleus0.280

Rank 2 · LXL04_030961 · OH-1004

Lysosome / Vacuole0.155

Rank 3 · LXL04_030961 · OH-1004

Golgi apparatus0.143

Rank 4 · LXL04_030961 · OH-1004

Cell membrane0.122

Rank 5 · LXL04_030961 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF21034.4BCAS3_WD4066-459 aa

PF21032.3PROPPIN352-544 aa

PF12490.14BCAS3569-714 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_030961	`PF21034.4`	BCAS3_WD40	66	459	3.5e-58	198.1
LXL04_030961	`PF21032.3`	PROPPIN	352	544	1.2e-07	32.0
LXL04_030961	`PF12490.14`	BCAS3	569	714	3.7e-44	151.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FH32`	Arabidopsis thaliana	Autophagy-related protein 18f	44.818%	Swiss-Prot	moderate database homology
`Q8GUL1`	Arabidopsis thaliana	Autophagy-related protein 18g	36.456%	Swiss-Prot	moderate database homology
`Q8H1Q5`	Arabidopsis thaliana	Autophagy-related protein 18h	36.506%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card