Gene Card
Gene overview
cDNA / CDS / Protein Sequences
900 bp · LXL04_030950|LXL04_030950|OH1004|cDNA
ATGAGACATCAAGAAGGAAGTTTATCATTTCATGGATCAAGATTTCGAGAAGCCACCGTAAAGATGACTCATCTTTACCGGAGAATCGTCCGATTAGACGTCCGATGGAGTGTTTTGCTGCAGAAAGTTTCCATTTTTCGAGAAATCTTTAGATTGATTTGGGATAAGTTTCTTGTTTGCTCTATGGGGAAGCCAGTCCGGTACCGGAGATTGTCTCGGCGGTCATCTTCTCCGATGGAAGATTTGGAATCTTGTTTTGA...
900 bp · LXL04_030950|LXL04_030950|OH1004|CDS
ATGAGACATCAAGAAGGAAGTTTATCATTTCATGGATCAAGATTTCGAGAAGCCACCGTAAAGATGACTCATCTTTACCGGAGAATCGTCCGATTAGACGTCCGATGGAGTGTTTTGCTGCAGAAAGTTTCCATTTTTCGAGAAATCTTTAGATTGATTTGGGATAAGTTTCTTGTTTGCTCTATGGGGAAGCCAGTCCGGTACCGGAGATTGTCTCGGCGGTCATCTTCTCCGATGGAAGATTTGGAATCTTGTTTTGA...
Protein
Download Protein FASTA299 aa · LXL04_030950|LXL04_030950|OH1004|PROTEIN
MRHQEGSLSFHGSRFREATVKMTHLYRRIVRLDVRWSVLLQKVSIFREIFRLIWDKFLVCSMGKPVRYRRLSRRSSSPMEDLESCFDLENPTTTTTATVTTCDSYEEDSDLVTLKISLLGDCQIGKTSFMIKYVGDEQENRSLEMAGLNLMDKTLSFGGARIAFSIWDVGGDKRSNDQVPLACKDSVAIFFMFDLTSRCTLHNVLEWYMQARKWNKTAIPILVGTKFDDFVRLPPDLQWTIVTQARTYAKVMKATLFFSS...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_030950 |
|---|---|
| TK1151 ID | TkA07G441000 |
| OH-1004 ID | LXL04_030950 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_030950 |
|---|---|
| Location | Chr06:125575013-125577723 (+) |
| Description | Similar to spg1: Septum-promoting GTP-binding protein 1 (Schizosaccharomyces pombe (strain 972 / ATCC 24843) |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0006886 intracellular protein transport Biological Process GO:0006897 endocytosis Biological Process GO:0015031 protein transport Biological Process GO:0023056 positive regulation of signaling Biological Process GO:0031028 septation initiation signaling Biological Process GO:0031536 positive regulation of exit from mitosis Biological Process GO:0031623 receptor internalization Biological Process GO:0032482 Rab protein signal transduction Biological Process GO:0032869 cellular response to insulin stimulus Biological Process GO:0040001 establishment of mitotic spindle localization Biological Process GO:0043001 Golgi to plasma membrane protein transport Biological Process GO:0045055 regulated exocytosis Biological Process |
| KEGG gene cross-reference | cfa:100683312 mmu:106572 rno:246324 sce:YML064C spo:2542761 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00071.29Ras115-277 aaPF08477.20Roc115-228 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_030950 | PF00071.29 | Ras | 115 | 277 | 1.1e-20 | 74.6 |
| LXL04_030950 | PF08477.20 | Roc | 115 | 228 | 5.8e-17 | 62.8 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.