LXL04_030904 | RubberDandelionOmics

Gene overview

LXL04_030904

Reference: OH-1004 Chr: Chr06 Coordinates: 124879509-124883323 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1371 bp · LXL04_030904|LXL04_030904|OH1004|cDNA

ATGGAATCCAACGGAGGAGTTGATGAATCGACCCGCTTGCTCCGGGAACTTCAGTCGCTGAAGGATTCGAAACGTGATATCGAGGCTCGCATATCGGTTATTGAAGCTcagcttcaacaaagtcaatCAAATCAGCTGCTCGATAAAAAAGCCTCTTCCGATTGTCCCAACTGCGTGTCCGATTCCGGCCATGACTTGACTCCAGATATGATTTACAGATACAGCCGTCAACTTTTACTTCCTTCTTTTGGCGTTAAAGG...

CDS

Download CDS FASTA

1371 bp · LXL04_030904|LXL04_030904|OH1004|CDS

ATGGAATCCAACGGAGGAGTTGATGAATCGACCCGCTTGCTCCGGGAACTTCAGTCGCTGAAGGATTCGAAACGTGATATCGAGGCTCGCATATCGGTTATTGAAGCTCAGCTTCAACAAAGTCAATCAAATCAGCTGCTCGATAAAAAAGCCTCTTCCGATTGTCCCAACTGCGTGTCCGATTCCGGCCATGACTTGACTCCAGATATGATTTACAGATACAGCCGTCAACTTTTACTTCCTTCTTTTGGCGTTAAAGG...

Protein

Download Protein FASTA

456 aa · LXL04_030904|LXL04_030904|OH1004|PROTEIN

MESNGGVDESTRLLRELQSLKDSKRDIEARISVIEAQLQQSQSNQLLDKKASSDCPNCVSDSGHDLTPDMIYRYSRQLLLPSFGVKGQSNLLKSSILVIGAGGLGSPALLYLAACGVGRLGMVDHDVVELNNLHRQIIHGEAYIGRSKVESAAAACRSINSTIEIIEHKEALRTSNALEIVSKYDIVIDATDNAPSRYMISDCCVLLGKPLVSGAALGLEGQLAVYNYNGGPCYRCLFPTPPPTTACQRCSDSGVLGVVP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030904`
TK1151 ID	TkA07G439960
OH-1004 ID	LXL04_030904
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_030904

Location Chr06:124879509-124883323 (+)

Description Similar to MOCS3: Adenylyltransferase and sulfurtransferase MOCS3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g55130`	Plays a central role in 2-thiolation of mcm(5)S(2)U at tRNA wobble positions of cytosolic tRNA(Lys), tRNA(Glu) and tRNA(Gln).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0804600`	Plays a central role in 2-thiolation of mcm(5)S(2)U at tRNA wobble positions of cytosolic tRNA(Lys), tRNA(Glu) and tRNA(Gln).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030904 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002098 tRNA wobble uridine modification Biological Process

GO:0002143 tRNA wobble position uridine thiolation Biological Process

GO:0006777 Mo-molybdopterin cofactor biosynthetic process Biological Process

GO:0032447 protein urmylation Biological Process

GO:0034227 tRNA thio-modification Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0004792 thiosulfate-cyanide sulfurtransferase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0008265 molybdenum cofactor sulfurtransferase activity Molecular Function

GO:0016779 nucleotidyltransferase activity Molecular Function

GO:0016783 sulfurtransferase activity Molecular Function

KEGG gene cross-reference

ath:AT5G55130

dre:393095

zma:100191959

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.460

Rank 1 · LXL04_030904 · OH-1004

Nucleus0.253

Rank 2 · LXL04_030904 · OH-1004

Plastid0.188

Rank 3 · LXL04_030904 · OH-1004

Mitochondrion0.183

Rank 4 · LXL04_030904 · OH-1004

Peroxisome0.110

Rank 5 · LXL04_030904 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00899.28ThiF74-310 aa

PF00581.26Rhodanese354-447 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_030904	`PF00899.28`	ThiF	74	310	2.1e-81	273.3
LXL04_030904	`PF00581.26`	Rhodanese	354	447	9.1e-13	49.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZNW0`	Arabidopsis thaliana	Adenylyltransferase and sulfurtransferase MOCS3	69.444%	Swiss-Prot	strong database homology
`A3ACF3`	Oryza sativa subsp. japonica	Adenylyltransferase and sulfurtransferase MOCS3	52.967%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card