LXL04_030900 | RubberDandelionOmics

Gene overview

LXL04_030900

Reference: OH-1004 Chr: Chr06 Coordinates: 124858018-124862966 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2418 bp · LXL04_030900|LXL04_030900|OH1004|cDNA

ATGGTGACCGGTGGTGTCATTTCCCAGATTCAAAGGACTGTAGTGACTCGGTGCCGAGCTTCCCTAATCTTCCATGTAGCTCATGATAATCGAAAGCTCATCCCGGTCATCCGGAATTCTTTTCACTCGCTCCATTGTGCCGAAAACAAGGGCGTAACAGTCGAAACAAAACCACACAATCCTGTTTTTACTTCCTACCTCATTCAAAAATTCGGAATATCTTCATCCGCATCTCTACATTCCAAACAAAACGGAACTTC...

CDS

Download CDS FASTA

2418 bp · LXL04_030900|LXL04_030900|OH1004|CDS

ATGGTGACCGGTGGTGTCATTTCCCAGATTCAAAGGACTGTAGTGACTCGGTGCCGAGCTTCCCTAATCTTCCATGTAGCTCATGATAATCGAAAGCTCATCCCGGTCATCCGGAATTCTTTTCACTCGCTCCATTGTGCCGAAAACAAGGGCGTAACAGTCGAAACAAAACCACACAATCCTGTTTTTACTTCCTACCTCATTCAAAAATTCGGAATATCTTCATCCGCATCTCTACATTCCAAACAAAACGGAACTTC...

Protein

Download Protein FASTA

805 aa · LXL04_030900|LXL04_030900|OH1004|PROTEIN

MVTGGVISQIQRTVVTRCRASLIFHVAHDNRKLIPVIRNSFHSLHCAENKGVTVETKPHNPVFTSYLIQKFGISSSASLHSKQNGTSQNEGESETANTPNDAKESEEAENSSKLDASDQKEEESSSEEEDLSVEDLVKLVTEKETLLKKKQKEIEEMKDKVLRTYAEMENVMERTKREAENSKKFAIQNFAKGLLDVADNLGRASSVVKESFVKIDTSQDSSGAVPLLKTLLEGVEMTEKQLSEVFKKFGVEKYDPTDEQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030900`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_030900

Location Chr06:124858018-124862966 (-)

Description Similar to FBL14: F-box/LRR-repeat protein 14

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g80570`	F-box/LRR-repeat protein 14.	No verified direct reference in this release
`At4g26780`	Essential component of the PAM complex, a complex required for the translocation of transit peptide-containing proteins from the inner membrane into the mitochondrial matrix in an ATP-dependent manner (By similarity).	Recent gene duplication and subfunctionalization produced a mitochondrial GrpE, the nucleotide exchange factor of the Hsp70 complex, specialized in thermotolerance to chronic heat stress in Arabidopsis.2012 · DOI: 10.1104/pp.111.187674
`At5g55200`	Essential component of the PAM complex, a complex required for the translocation of transit peptide-containing proteins from the inner membrane into the mitochondrial matrix in an ATP-dependent manner (By similarity).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030900 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006457 protein folding Biological Process

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0009408 response to heat Biological Process

GO:0009411 response to UV Biological Process

GO:0010286 heat acclimation Biological Process

GO:0030150 protein import into mitochondrial matrix Biological Process

GO:0031146 SCF-dependent proteasomal ubiquitin-dependent protein catabolic process Biological Process

GO:0001405 PAM complex, Tim23 associated import motor Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G80570

ath:AT4G26780

ath:AT5G55200

nwi:Nwi_0195

oca:OCAR_4415

ocg:OCA5_c01160

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.709

Rank 1 · LXL04_030900 · OH-1004

Plastid0.180

Rank 2 · LXL04_030900 · OH-1004

Cytoplasm0.107

Rank 3 · LXL04_030900 · OH-1004

Nucleus0.098

Rank 4 · LXL04_030900 · OH-1004

Peroxisome0.021

Rank 5 · LXL04_030900 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01025.25GrpE137-302 aa

PF25372.2LRR_FBXL15421-524 aa

PF29594.1LRR_SKP2424-545 aa

PF25372.2LRR_FBXL15713-788 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_030900	`PF01025.25`	GrpE	137	302	2.2e-46	158.3
LXL04_030900	`PF25372.2`	LRR_FBXL15	421	524	2e-13	50.3
LXL04_030900	`PF29594.1`	LRR_SKP2	424	545	2.7e-09	37.4
LXL04_030900	`PF25372.2`	LRR_FBXL15	713	788	2e-13	50.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q3EC97`	Arabidopsis thaliana	F-box/LRR-repeat protein 14	61.456%	Swiss-Prot	moderate database homology
`Q8LB47`	Arabidopsis thaliana	GrpE protein homolog 2, mitochondrial	53.191%	Swiss-Prot	weak database homology
`Q9FLP3`	Arabidopsis thaliana	GrpE protein homolog 1, mitochondrial	53.289%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card