LXL04_030855 | RubberDandelionOmics

Gene overview

LXL04_030855

Reference: OH-1004 Chr: Chr06 Coordinates: 124202766-124206246 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

945 bp · LXL04_030855|LXL04_030855|OH1004|cDNA

ATGGTTCTATCGCAAAAGCTCCACGAGGCATTCAAAGGTACGGTAGAGCGGATCACGAACCCTAGGACTGTATCTGCTTTCAAAGAGAAAGGTGTACTTAGCGTTAATGAATTCGTCATCGCCGGAGACAATCTCGTTTCCAAGTGTCCTACTTGGTCATGGGAATCAGGTGATCCAAACAAAAGGAAGTCGTATTTGCCATCTGATAAACAGTTTTTGATCACTAGAAATGTTCCTTGTTTGAAAAGAGTTGCATCAAT...

CDS

Download CDS FASTA

945 bp · LXL04_030855|LXL04_030855|OH1004|CDS

ATGGTTCTATCGCAAAAGCTCCACGAGGCATTCAAAGGTACGGTAGAGCGGATCACGAACCCTAGGACTGTATCTGCTTTCAAAGAGAAAGGTGTACTTAGCGTTAATGAATTCGTCATCGCCGGAGACAATCTCGTTTCCAAGTGTCCTACTTGGTCATGGGAATCAGGTGATCCAAACAAAAGGAAGTCGTATTTGCCATCTGATAAACAGTTTTTGATCACTAGAAATGTTCCTTGTTTGAAAAGAGTTGCATCAAT...

Protein

Download Protein FASTA

314 aa · LXL04_030855|LXL04_030855|OH1004|PROTEIN

MVLSQKLHEAFKGTVERITNPRTVSAFKEKGVLSVNEFVIAGDNLVSKCPTWSWESGDPNKRKSYLPSDKQFLITRNVPCLKRVASIQEEYEAAGGEILLDDEENDGWLATHGQPKDTKIDEEENVPCMETLEISNKNTIQSIPSYFGNQEEEDIPDMEEFEEPDNLIESDPATLQPTYLVAHEPDDDIILRTRTYDVSITYDKYYQTPRVWLTGYDESRMLLEPELVLEDVSQDHARKTVTIEDHPHLPGKHASVHPCK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030855`
TK1151 ID	TkA07G437310
OH-1004 ID	LXL04_030855
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_030855

Location Chr06:124202766-124206246 (+)

Description Similar to ATG3: Autophagy-related protein 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g61500`	E2 conjugating enzyme responsible for the E2-like covalent binding of phosphatidylethanolamine to the C-terminal Gly of ATG8.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030855 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000045 autophagosome assembly Biological Process

GO:0000422 autophagy of mitochondrion Biological Process

GO:0006612 protein targeting to membrane Biological Process

GO:0006914 autophagy Biological Process

GO:0015031 protein transport Biological Process

GO:0016236 macroautophagy Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0044804 nucleophagy Biological Process

GO:0050765 negative regulation of phagocytosis Biological Process

GO:0061723 glycophagy Biological Process

GO:1902017 regulation of cilium assembly Biological Process

GO:0000153 cytoplasmic ubiquitin ligase complex Cellular Component

KEGG gene cross-reference

ath:AT5G61500

bta:508571

ddi:DDB_G0277319

hsa:64422

mmu:67841

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.702

Rank 1 · LXL04_030855 · OH-1004

Nucleus0.293

Rank 2 · LXL04_030855 · OH-1004

Golgi apparatus0.129

Rank 3 · LXL04_030855 · OH-1004

Endoplasmic reticulum0.084

Rank 4 · LXL04_030855 · OH-1004

Cell membrane0.065

Rank 5 · LXL04_030855 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03987.21Autophagy_act_C37-303 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_030855	`PF03987.21`	Autophagy_act_C	37	303	8e-60	202.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WWQ1`	Arabidopsis thaliana	Autophagy-related protein 3	81.847%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card